Incidental Mutation 'R1475:Il23r'
ID163997
Institutional Source Beutler Lab
Gene Symbol Il23r
Ensembl Gene ENSMUSG00000049093
Gene Nameinterleukin 23 receptor
Synonyms
MMRRC Submission 039528-MU
Accession Numbers

Ncbi RefSeq: NM_144548.1; MGI:2181693

Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R1475 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location67422932-67491855 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 67452296 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118364]
Predicted Effect probably null
Transcript: ENSMUST00000118364
SMART Domains Protein: ENSMUSP00000113342
Gene: ENSMUSG00000049093

DomainStartEndE-ValueType
FN3 140 220 1e-1 SMART
Blast:FN3 235 317 2e-38 BLAST
transmembrane domain 388 410 N/A INTRINSIC
Meta Mutation Damage Score 0.534 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 96% (46/48)
MGI Phenotype Strain: 4355925
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the receptor for IL23A/IL23. This protein pairs with the receptor molecule IL12RB1/IL12Rbeta1, and both are required for IL23A signaling. This protein associates constitutively with Janus kinase 2 (JAK2), and also binds to transcription activator STAT3 in a ligand-dependent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Th17 T cells from homozygous null mice have less secretion of IL-9 upon secondary stimulation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik A T 8: 121,540,588 probably benign Het
9230112D13Rik T A 14: 34,512,055 D93V unknown Het
Aatk G A 11: 120,010,888 T894M probably damaging Het
Acacb T C 5: 114,195,252 I479T possibly damaging Het
Acap3 T C 4: 155,902,821 I431T probably damaging Het
Adgrl1 A G 8: 83,938,350 K1267R possibly damaging Het
Bphl A C 13: 34,060,524 D208A probably benign Het
C2cd5 T C 6: 143,072,572 D308G possibly damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Cdk11b G A 4: 155,634,217 R208H probably damaging Het
Cfap44 T C 16: 44,433,812 probably benign Het
Chrna4 T C 2: 181,029,379 S195G probably benign Het
Cpsf2 T C 12: 101,985,236 L144S probably damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Dffa T A 4: 149,117,478 L171Q probably damaging Het
Emcn C T 3: 137,379,907 H89Y possibly damaging Het
Espn G A 4: 152,134,271 P452S probably damaging Het
Fam78b T A 1: 167,001,777 I71N probably damaging Het
Fam89b A G 19: 5,729,419 S37P probably damaging Het
Fat4 G A 3: 38,888,323 R455H probably damaging Het
Fbxo6 A G 4: 148,146,110 F232L probably benign Het
Fcamr T A 1: 130,814,484 probably null Het
Fermt3 T C 19: 7,018,874 probably null Het
Fsip2 A T 2: 82,987,195 D4424V probably damaging Het
Gaa G A 11: 119,274,316 probably null Het
Glce T C 9: 62,060,928 T314A possibly damaging Het
Hdac5 T C 11: 102,202,186 Q575R possibly damaging Het
Kcnj4 T A 15: 79,484,630 E383V probably damaging Het
Lrsam1 G T 2: 32,954,265 Q115K possibly damaging Het
Lyst T A 13: 13,708,212 probably null Het
Myf5 A G 10: 107,484,654 V190A probably benign Het
Nmnat2 G A 1: 153,074,695 R42H probably damaging Het
Olfr1051 A T 2: 86,275,561 *309R probably null Het
Olfr901 T A 9: 38,430,864 V194D probably benign Het
Osbpl1a T A 18: 12,757,680 K380M probably damaging Het
Pgd T C 4: 149,156,775 T226A probably benign Het
Pitpnm3 T C 11: 72,074,627 T127A probably damaging Het
Plekhm2 T C 4: 141,627,854 D954G possibly damaging Het
Pramef17 T C 4: 143,994,312 K20E probably benign Het
Rasal1 T A 5: 120,662,982 F236I possibly damaging Het
Stab1 T C 14: 31,163,828 N63S probably benign Het
Syf2 T A 4: 134,935,434 M145K possibly damaging Het
Usp34 C A 11: 23,473,253 L3152I probably damaging Het
Usp50 T C 2: 126,769,867 probably null Het
Wdfy4 A T 14: 33,108,688 I929N probably benign Het
Zfp874b A T 13: 67,474,092 probably null Het
Other mutations in Il23r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Il23r APN 6 67423628 missense probably damaging 0.96
IGL00886:Il23r APN 6 67473890 missense possibly damaging 0.94
IGL00916:Il23r APN 6 67473931 missense probably damaging 1.00
IGL01102:Il23r APN 6 67423925 missense probably damaging 0.98
IGL01466:Il23r APN 6 67426642 missense probably benign 0.30
IGL01627:Il23r APN 6 67423428 missense probably benign 0.17
IGL02160:Il23r APN 6 67423578 missense probably benign 0.09
IGL02394:Il23r APN 6 67466272 splice site probably benign
IGL02418:Il23r APN 6 67490672 missense possibly damaging 0.46
IGL02818:Il23r APN 6 67486094 critical splice donor site probably null
IGL03230:Il23r APN 6 67423964 missense probably benign 0.31
R0029:Il23r UTSW 6 67478945 critical splice donor site probably null
R0029:Il23r UTSW 6 67478945 critical splice donor site probably null
R0035:Il23r UTSW 6 67473788 splice site probably benign
R0035:Il23r UTSW 6 67473788 splice site probably benign
R0085:Il23r UTSW 6 67486222 missense probably damaging 1.00
R0477:Il23r UTSW 6 67452377 missense probably benign 0.00
R0534:Il23r UTSW 6 67426588 missense probably benign 0.00
R0547:Il23r UTSW 6 67423701 missense probably benign 0.05
R0547:Il23r UTSW 6 67486251 missense possibly damaging 0.57
R0666:Il23r UTSW 6 67434680 missense probably benign 0.08
R0702:Il23r UTSW 6 67466285 missense probably damaging 0.97
R0715:Il23r UTSW 6 67486333 missense possibly damaging 0.63
R1077:Il23r UTSW 6 67473810 missense probably benign 0.40
R1202:Il23r UTSW 6 67478953 missense possibly damaging 0.95
R1328:Il23r UTSW 6 67491818 start gained probably benign
R1378:Il23r UTSW 6 67452410 missense possibly damaging 0.68
R1420:Il23r UTSW 6 67486197 missense probably damaging 1.00
R1628:Il23r UTSW 6 67423609 missense probably damaging 1.00
R1745:Il23r UTSW 6 67466291 missense probably damaging 0.98
R1887:Il23r UTSW 6 67473801 missense possibly damaging 0.88
R1901:Il23r UTSW 6 67423734 missense probably benign 0.44
R1902:Il23r UTSW 6 67423734 missense probably benign 0.44
R1928:Il23r UTSW 6 67423735 missense possibly damaging 0.79
R1984:Il23r UTSW 6 67490668 splice site probably null
R1985:Il23r UTSW 6 67490668 splice site probably null
R2264:Il23r UTSW 6 67426667 critical splice acceptor site probably null
R2290:Il23r UTSW 6 67423861 missense probably benign 0.17
R2363:Il23r UTSW 6 67452417 missense probably benign 0.08
R3430:Il23r UTSW 6 67452474 missense probably benign 0.08
R3964:Il23r UTSW 6 67466297 missense probably benign 0.13
R4073:Il23r UTSW 6 67486122 missense probably damaging 1.00
R4164:Il23r UTSW 6 67423663 missense probably benign 0.00
R4643:Il23r UTSW 6 67423993 missense probably benign 0.08
R4700:Il23r UTSW 6 67473850 missense probably damaging 1.00
R4703:Il23r UTSW 6 67490702 missense probably damaging 1.00
R4720:Il23r UTSW 6 67423661 missense probably damaging 1.00
R4828:Il23r UTSW 6 67431651 missense probably benign 0.31
R4911:Il23r UTSW 6 67423561 missense probably benign 0.17
R5119:Il23r UTSW 6 67466316 missense probably damaging 1.00
R5152:Il23r UTSW 6 67423741 missense probably damaging 0.98
R5223:Il23r UTSW 6 67486170 missense probably benign 0.23
R5271:Il23r UTSW 6 67423696 missense probably benign 0.16
R5330:Il23r UTSW 6 67423495 missense probably damaging 1.00
R5331:Il23r UTSW 6 67423495 missense probably damaging 1.00
R5384:Il23r UTSW 6 67486291 missense probably benign 0.10
R5874:Il23r UTSW 6 67431645 missense possibly damaging 0.92
R6037:Il23r UTSW 6 67478954 missense probably damaging 0.99
R6037:Il23r UTSW 6 67478954 missense probably damaging 0.99
R6377:Il23r UTSW 6 67423652 missense probably damaging 0.99
R6925:Il23r UTSW 6 67423493 missense probably damaging 1.00
R6975:Il23r UTSW 6 67423368 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCCAATGGTGTGTGGAATCAAG -3'
(R):5'- ACCTGGAGCCAGACAGCAAGTATG -3'

Sequencing Primer
(F):5'- GTGGAATCAAGAACCCTTTGTG -3'
(R):5'- TGTATTTCAAGTGCGATGTCAAG -3'
Posted On2014-03-28