Incidental Mutation 'R1475:1700018B08Rik'
List |< first << previous [record 45 of 19097] next >> last >|
ID164001
Institutional Source Beutler Lab
Gene Symbol 1700018B08Rik
Ensembl Gene ENSMUSG00000031809
Gene NameRIKEN cDNA 1700018B08 gene
Synonyms
MMRRC Submission 039528-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.038) question?
Stock #R1475 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location121530780-121544320 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 121540588 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034265] [ENSMUST00000127664] [ENSMUST00000182460] [ENSMUST00000182739] [ENSMUST00000183280]
Predicted Effect probably benign
Transcript: ENSMUST00000034265
SMART Domains Protein: ENSMUSP00000034265
Gene: ENSMUSG00000031809

DomainStartEndE-ValueType
Pfam:DUF4568 3 213 1.4e-118 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182145
Predicted Effect probably benign
Transcript: ENSMUST00000182460
SMART Domains Protein: ENSMUSP00000138106
Gene: ENSMUSG00000031809

DomainStartEndE-ValueType
Pfam:DUF4568 23 188 7.2e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182739
Predicted Effect probably benign
Transcript: ENSMUST00000183280
SMART Domains Protein: ENSMUSP00000138141
Gene: ENSMUSG00000031809

DomainStartEndE-ValueType
Pfam:DUF4568 3 48 2.1e-6 PFAM
Meta Mutation Damage Score 0.1056 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230112D13Rik T A 14: 34,512,055 D93V unknown Het
Aatk G A 11: 120,010,888 T894M probably damaging Het
Acacb T C 5: 114,195,252 I479T possibly damaging Het
Acap3 T C 4: 155,902,821 I431T probably damaging Het
Adgrl1 A G 8: 83,938,350 K1267R possibly damaging Het
Bphl A C 13: 34,060,524 D208A probably benign Het
C2cd5 T C 6: 143,072,572 D308G possibly damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Cdk11b G A 4: 155,634,217 R208H probably damaging Het
Cfap44 T C 16: 44,433,812 probably benign Het
Chrna4 T C 2: 181,029,379 S195G probably benign Het
Cpsf2 T C 12: 101,985,236 L144S probably damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Dffa T A 4: 149,117,478 L171Q probably damaging Het
Emcn C T 3: 137,379,907 H89Y possibly damaging Het
Espn G A 4: 152,134,271 P452S probably damaging Het
Fam78b T A 1: 167,001,777 I71N probably damaging Het
Fam89b A G 19: 5,729,419 S37P probably damaging Het
Fat4 G A 3: 38,888,323 R455H probably damaging Het
Fbxo6 A G 4: 148,146,110 F232L probably benign Het
Fcamr T A 1: 130,814,484 probably null Het
Fermt3 T C 19: 7,018,874 probably null Het
Fsip2 A T 2: 82,987,195 D4424V probably damaging Het
Gaa G A 11: 119,274,316 probably null Het
Glce T C 9: 62,060,928 T314A possibly damaging Het
Hdac5 T C 11: 102,202,186 Q575R possibly damaging Het
Il23r C A 6: 67,452,296 probably null Het
Kcnj4 T A 15: 79,484,630 E383V probably damaging Het
Lrsam1 G T 2: 32,954,265 Q115K possibly damaging Het
Lyst T A 13: 13,708,212 probably null Het
Myf5 A G 10: 107,484,654 V190A probably benign Het
Nmnat2 G A 1: 153,074,695 R42H probably damaging Het
Olfr1051 A T 2: 86,275,561 *309R probably null Het
Olfr901 T A 9: 38,430,864 V194D probably benign Het
Osbpl1a T A 18: 12,757,680 K380M probably damaging Het
Pgd T C 4: 149,156,775 T226A probably benign Het
Pitpnm3 T C 11: 72,074,627 T127A probably damaging Het
Plekhm2 T C 4: 141,627,854 D954G possibly damaging Het
Pramef17 T C 4: 143,994,312 K20E probably benign Het
Rasal1 T A 5: 120,662,982 F236I possibly damaging Het
Stab1 T C 14: 31,163,828 N63S probably benign Het
Syf2 T A 4: 134,935,434 M145K possibly damaging Het
Usp34 C A 11: 23,473,253 L3152I probably damaging Het
Usp50 T C 2: 126,769,867 probably null Het
Wdfy4 A T 14: 33,108,688 I929N probably benign Het
Zfp874b A T 13: 67,474,092 probably null Het
Other mutations in 1700018B08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02700:1700018B08Rik APN 8 121535422 critical splice donor site probably null
IGL03124:1700018B08Rik APN 8 121541710 splice site probably benign
R2883:1700018B08Rik UTSW 8 121539905 missense probably damaging 1.00
R3967:1700018B08Rik UTSW 8 121539980 missense possibly damaging 0.52
R6281:1700018B08Rik UTSW 8 121531881 missense probably damaging 1.00
R6490:1700018B08Rik UTSW 8 121540554 missense probably benign 0.06
R6920:1700018B08Rik UTSW 8 121535421 critical splice donor site probably null
R6934:1700018B08Rik UTSW 8 121539973 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGCACAGACCACTTATTAGGACCAC -3'
(R):5'- ACAGGGTCTCACACCAGTTAGGAAG -3'

Sequencing Primer
(F):5'- AGGTGCCGATGACCAGG -3'
(R):5'- CACCAGTTAGGAAGATATCACCTGTG -3'
Posted On2014-03-28