Incidental Mutation 'R1476:Mga'
ID164040
Institutional Source Beutler Lab
Gene Symbol Mga
Ensembl Gene ENSMUSG00000033943
Gene NameMAX gene associated
SynonymsD030062C11Rik, Mga, Mad5, C130042M01Rik
MMRRC Submission 039529-MU
Accession Numbers

Ncbi RefSeq: NM_013720.2, NM_001164274.1; MGI: 1352483

Is this an essential gene? Possibly essential (E-score: 0.719) question?
Stock #R1476 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location119897228-119969581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119941675 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1672 (V1672E)
Ref Sequence ENSEMBL: ENSMUSP00000106401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046717] [ENSMUST00000079934] [ENSMUST00000110773] [ENSMUST00000110774] [ENSMUST00000156510]
Predicted Effect probably damaging
Transcript: ENSMUST00000046717
AA Change: V1672E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043795
Gene: ENSMUSG00000033943
AA Change: V1672E

DomainStartEndE-ValueType
Blast:TBOX 6 73 6e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1796 1818 N/A INTRINSIC
low complexity region 1833 1850 N/A INTRINSIC
low complexity region 1977 1992 N/A INTRINSIC
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2241 2259 N/A INTRINSIC
HLH 2368 2419 8.27e-7 SMART
low complexity region 2748 2769 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079934
SMART Domains Protein: ENSMUSP00000078853
Gene: ENSMUSG00000033943

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
low complexity region 2578 2599 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110773
AA Change: V1593E

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106400
Gene: ENSMUSG00000033943
AA Change: V1593E

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 890 899 N/A INTRINSIC
low complexity region 938 952 N/A INTRINSIC
low complexity region 1033 1059 N/A INTRINSIC
low complexity region 1169 1190 N/A INTRINSIC
low complexity region 1222 1236 N/A INTRINSIC
low complexity region 1485 1502 N/A INTRINSIC
low complexity region 1555 1570 N/A INTRINSIC
low complexity region 1602 1637 N/A INTRINSIC
low complexity region 1717 1739 N/A INTRINSIC
low complexity region 1754 1771 N/A INTRINSIC
low complexity region 1898 1913 N/A INTRINSIC
low complexity region 2104 2118 N/A INTRINSIC
low complexity region 2162 2180 N/A INTRINSIC
HLH 2289 2340 8.27e-7 SMART
low complexity region 2669 2690 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110774
AA Change: V1672E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106401
Gene: ENSMUSG00000033943
AA Change: V1672E

DomainStartEndE-ValueType
Blast:TBOX 6 73 7e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
Pfam:DUF4801 1037 1085 1e-19 PFAM
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1835 1857 N/A INTRINSIC
low complexity region 1872 1889 N/A INTRINSIC
low complexity region 2016 2031 N/A INTRINSIC
low complexity region 2222 2236 N/A INTRINSIC
low complexity region 2280 2298 N/A INTRINSIC
HLH 2407 2458 8.27e-7 SMART
low complexity region 2787 2808 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156074
Predicted Effect probably benign
Transcript: ENSMUST00000156510
SMART Domains Protein: ENSMUSP00000119044
Gene: ENSMUSG00000033943

DomainStartEndE-ValueType
Blast:TBOX 6 73 4e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
Meta Mutation Damage Score 0.226 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 95% (80/84)
MGI Phenotype PHENOTYPE: Embryos homozygous for a gene trap allele die shortly after implantation due to defective development of the inner cell mass (ICM) and the epiblast. ICM derivatives fail to develop past E4.5 and show increased apoptosis but no change in cell proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(135) : Gene trapped(135)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,702 probably benign Het
4932431P20Rik A G 7: 29,534,890 noncoding transcript Het
A730015C16Rik G A 4: 108,848,008 V40M probably damaging Het
Abcg2 A G 6: 58,678,337 D419G probably benign Het
Adamts17 A C 7: 67,075,343 E777A probably damaging Het
Ak1 A G 2: 32,633,466 K166R probably benign Het
Ankrd12 T C 17: 65,986,305 K711R probably damaging Het
Ate1 A T 7: 130,418,571 probably null Het
Atp5a1 A G 18: 77,781,925 H519R probably benign Het
Best1 G T 19: 9,990,489 Y284* probably null Het
C2cd6 A G 1: 59,076,728 probably benign Het
Casz1 G T 4: 148,946,171 V1216L probably benign Het
Cdc42bpg A G 19: 6,313,782 D493G probably damaging Het
Ces2f A G 8: 104,952,502 D317G possibly damaging Het
Chst15 A T 7: 132,270,273 M93K possibly damaging Het
Cntnap5a T C 1: 115,901,020 L58P probably damaging Het
Crip3 T C 17: 46,430,776 probably benign Het
Csmd2 G A 4: 128,487,001 E2117K probably benign Het
Cstf3 A G 2: 104,648,219 D212G possibly damaging Het
Cttnbp2 T C 6: 18,434,221 K546R probably damaging Het
Cubn A G 2: 13,476,120 I308T probably benign Het
Cxcl9 T A 5: 92,325,113 D75V probably damaging Het
Dcdc5 C T 2: 106,358,632 noncoding transcript Het
Defa30 C A 8: 21,134,736 T25K possibly damaging Het
Dock7 A T 4: 99,079,435 H239Q possibly damaging Het
Dpp4 A G 2: 62,347,901 V629A possibly damaging Het
Fam83a T C 15: 58,009,945 M390T probably benign Het
Fem1c A G 18: 46,524,485 L54P probably damaging Het
Fntb T A 12: 76,910,233 M282K probably benign Het
Gm11099 G A 2: 58,859,470 probably benign Het
Gm1527 T C 3: 28,926,556 S602P probably benign Het
Gm20388 A G 8: 122,269,584 probably benign Het
Gm5478 T A 15: 101,644,645 I331F probably damaging Het
Gm7853 C A 14: 36,089,583 noncoding transcript Het
Gsta2 A T 9: 78,341,865 C18S probably benign Het
H1foo T C 6: 115,947,740 V69A possibly damaging Het
Hecw1 T C 13: 14,306,086 E465G probably damaging Het
Herc1 A G 9: 66,508,266 D4841G probably damaging Het
Hus1b A G 13: 30,947,001 V225A probably benign Het
Keg1 A T 19: 12,716,023 M137L probably benign Het
Kmt2a C T 9: 44,824,635 probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mios T C 6: 8,234,237 S803P probably benign Het
Mkl1 T C 15: 81,018,208 probably benign Het
Msh4 A T 3: 153,863,384 Y851N probably damaging Het
Mybl1 A C 1: 9,672,661 probably null Het
Myo5c A G 9: 75,275,939 Y865C probably damaging Het
Naip1 T C 13: 100,426,870 S596G probably benign Het
Nek5 G T 8: 22,096,731 Q355K possibly damaging Het
Nphp3 G T 9: 104,025,927 R701L possibly damaging Het
Olfr1006 T A 2: 85,674,918 T78S possibly damaging Het
Olfr1023 T A 2: 85,887,248 Y149* probably null Het
Olfr1052 T C 2: 86,298,479 I221T probably damaging Het
Olfr1094 T C 2: 86,829,198 S149P probably benign Het
Olfr666 A T 7: 104,893,237 Y130* probably null Het
Palm A G 10: 79,815,187 N149D possibly damaging Het
Pot1b T C 17: 55,653,451 I626M possibly damaging Het
Ptprt T A 2: 161,927,484 D487V probably damaging Het
Qpct A G 17: 79,070,772 I124V probably benign Het
Rbm12b1 T A 4: 12,145,817 D596E possibly damaging Het
Rnf157 A G 11: 116,354,759 C277R probably damaging Het
Rnf169 A G 7: 99,925,328 S687P possibly damaging Het
Sfxn1 T A 13: 54,092,450 probably null Het
Slc6a21 T C 7: 45,272,628 V649A probably benign Het
Slit3 A T 11: 35,686,299 T1120S probably damaging Het
Spem2 A T 11: 69,818,070 M58K probably benign Het
Sprr2k T A 3: 92,433,396 probably benign Het
Sspo T C 6: 48,463,400 probably null Het
Sv2b A T 7: 75,120,043 F584I possibly damaging Het
Tkfc A T 19: 10,595,326 M317K probably null Het
Tnni3k C T 3: 155,030,305 G134S probably benign Het
Ttn C T 2: 76,739,780 R26923H probably damaging Het
Tuba3b T C 6: 145,618,453 V75A possibly damaging Het
Unc79 T C 12: 103,183,525 L2626P probably damaging Het
Usp24 A T 4: 106,361,933 I491F probably damaging Het
V1ra8 A T 6: 90,203,150 I112F probably damaging Het
Vmn1r29 T G 6: 58,307,678 F128V probably benign Het
Zfp157 T A 5: 138,455,095 probably null Het
Other mutations in Mga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Mga APN 2 119919814 missense possibly damaging 0.65
IGL00719:Mga APN 2 119947453 nonsense probably null
IGL01619:Mga APN 2 119931828 missense possibly damaging 0.46
IGL01721:Mga APN 2 119935239 missense probably damaging 1.00
IGL01759:Mga APN 2 119951195 missense possibly damaging 0.92
IGL01785:Mga APN 2 119902912 missense probably damaging 1.00
IGL01786:Mga APN 2 119902912 missense probably damaging 1.00
IGL01950:Mga APN 2 119941654 missense possibly damaging 0.60
IGL01960:Mga APN 2 119938657 missense probably damaging 1.00
IGL02086:Mga APN 2 119924036 missense probably damaging 0.99
IGL02364:Mga APN 2 119964054 missense possibly damaging 0.66
IGL02602:Mga APN 2 119931884 missense possibly damaging 0.66
IGL02751:Mga APN 2 119947770 missense possibly damaging 0.82
IGL02794:Mga APN 2 119946289 missense possibly damaging 0.84
IGL03247:Mga APN 2 119935513 missense possibly damaging 0.81
IGL03303:Mga APN 2 119903452 missense probably damaging 1.00
R0060:Mga UTSW 2 119960961 critical splice donor site probably null
R0060:Mga UTSW 2 119960961 critical splice donor site probably null
R0417:Mga UTSW 2 119902790 missense probably damaging 0.99
R0449:Mga UTSW 2 119941381 missense probably damaging 1.00
R0457:Mga UTSW 2 119916488 missense probably damaging 0.98
R0538:Mga UTSW 2 119919706 critical splice donor site probably null
R0568:Mga UTSW 2 119935422 missense probably damaging 1.00
R0614:Mga UTSW 2 119964466 missense probably damaging 1.00
R0671:Mga UTSW 2 119919910 splice site probably null
R0811:Mga UTSW 2 119947961 missense probably damaging 0.99
R0812:Mga UTSW 2 119947961 missense probably damaging 0.99
R0948:Mga UTSW 2 119941659 missense possibly damaging 0.77
R1177:Mga UTSW 2 119926446 missense probably damaging 1.00
R1445:Mga UTSW 2 119902698 missense probably damaging 1.00
R1527:Mga UTSW 2 119916597 missense probably damaging 1.00
R1583:Mga UTSW 2 119963960 missense possibly damaging 0.66
R1592:Mga UTSW 2 119964666 missense possibly damaging 0.93
R1627:Mga UTSW 2 119964562 missense probably damaging 1.00
R1658:Mga UTSW 2 119941689 missense possibly damaging 0.63
R1677:Mga UTSW 2 119960852 missense possibly damaging 0.92
R1887:Mga UTSW 2 119923617 missense probably damaging 1.00
R1908:Mga UTSW 2 119926594 missense possibly damaging 0.66
R1909:Mga UTSW 2 119926594 missense possibly damaging 0.66
R2061:Mga UTSW 2 119964980 unclassified probably benign
R2145:Mga UTSW 2 119964157 missense possibly damaging 0.85
R2159:Mga UTSW 2 119919643 missense probably damaging 0.96
R2179:Mga UTSW 2 119960442 missense probably damaging 0.99
R2281:Mga UTSW 2 119903723 missense probably benign
R2423:Mga UTSW 2 119964793 missense probably damaging 1.00
R3620:Mga UTSW 2 119916668 missense probably damaging 1.00
R3622:Mga UTSW 2 119941764 missense probably damaging 1.00
R3624:Mga UTSW 2 119941764 missense probably damaging 1.00
R3802:Mga UTSW 2 119947339 missense probably damaging 0.96
R4011:Mga UTSW 2 119931780 missense probably damaging 1.00
R4065:Mga UTSW 2 119947002 missense probably damaging 1.00
R4520:Mga UTSW 2 119948098 missense possibly damaging 0.85
R4649:Mga UTSW 2 119941493 missense possibly damaging 0.81
R4660:Mga UTSW 2 119938623 intron probably benign
R4757:Mga UTSW 2 119903639 missense possibly damaging 0.82
R4771:Mga UTSW 2 119964294 missense probably damaging 1.00
R4784:Mga UTSW 2 119903057 missense probably damaging 1.00
R4866:Mga UTSW 2 119964054 missense possibly damaging 0.66
R4900:Mga UTSW 2 119964054 missense possibly damaging 0.66
R4952:Mga UTSW 2 119903301 missense probably damaging 1.00
R4995:Mga UTSW 2 119932582 nonsense probably null
R5020:Mga UTSW 2 119951173 nonsense probably null
R5082:Mga UTSW 2 119903344 missense probably damaging 0.98
R5208:Mga UTSW 2 119947981 missense possibly damaging 0.83
R5454:Mga UTSW 2 119903329 missense probably damaging 0.99
R5466:Mga UTSW 2 119902697 missense probably damaging 1.00
R5484:Mga UTSW 2 119916626 missense possibly damaging 0.58
R5669:Mga UTSW 2 119903426 missense probably damaging 1.00
R5819:Mga UTSW 2 119941263 missense possibly damaging 0.61
R5916:Mga UTSW 2 119964312 missense probably benign 0.27
R5942:Mga UTSW 2 119946959 missense probably benign 0.41
R6305:Mga UTSW 2 119947698 missense probably benign 0.00
R6434:Mga UTSW 2 119923938 missense probably damaging 0.99
R6467:Mga UTSW 2 119946295 missense probably damaging 1.00
R6488:Mga UTSW 2 119960907 missense probably damaging 1.00
R6630:Mga UTSW 2 119923659 missense probably damaging 0.99
R6790:Mga UTSW 2 119923754 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACCTGTGGTTTCTTCTGAGCAAG -3'
(R):5'- AACTAGTCCTTACCTGGTCTCTGGC -3'

Sequencing Primer
(F):5'- CAAGTTCAGGTGTGCAGC -3'
(R):5'- CTGGTCTCTGGCTCACG -3'
Posted On2014-03-28