Incidental Mutation 'R1476:Csmd2'
ID164050
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene NameCUB and Sushi multiple domains 2
Synonyms
MMRRC Submission 039529-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R1476 (G1)
Quality Score222
Status Validated
Chromosome4
Chromosomal Location127987857-128567656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128487001 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 2117 (E2117K)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Predicted Effect
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148247
Predicted Effect probably benign
Transcript: ENSMUST00000184063
AA Change: E2117K

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 95% (80/84)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,702 probably benign Het
4932431P20Rik A G 7: 29,534,890 noncoding transcript Het
A730015C16Rik G A 4: 108,848,008 V40M probably damaging Het
Abcg2 A G 6: 58,678,337 D419G probably benign Het
Adamts17 A C 7: 67,075,343 E777A probably damaging Het
Ak1 A G 2: 32,633,466 K166R probably benign Het
Ankrd12 T C 17: 65,986,305 K711R probably damaging Het
Ate1 A T 7: 130,418,571 probably null Het
Atp5a1 A G 18: 77,781,925 H519R probably benign Het
Best1 G T 19: 9,990,489 Y284* probably null Het
C2cd6 A G 1: 59,076,728 probably benign Het
Casz1 G T 4: 148,946,171 V1216L probably benign Het
Cdc42bpg A G 19: 6,313,782 D493G probably damaging Het
Ces2f A G 8: 104,952,502 D317G possibly damaging Het
Chst15 A T 7: 132,270,273 M93K possibly damaging Het
Cntnap5a T C 1: 115,901,020 L58P probably damaging Het
Crip3 T C 17: 46,430,776 probably benign Het
Cstf3 A G 2: 104,648,219 D212G possibly damaging Het
Cttnbp2 T C 6: 18,434,221 K546R probably damaging Het
Cubn A G 2: 13,476,120 I308T probably benign Het
Cxcl9 T A 5: 92,325,113 D75V probably damaging Het
Dcdc5 C T 2: 106,358,632 noncoding transcript Het
Defa30 C A 8: 21,134,736 T25K possibly damaging Het
Dock7 A T 4: 99,079,435 H239Q possibly damaging Het
Dpp4 A G 2: 62,347,901 V629A possibly damaging Het
Fam83a T C 15: 58,009,945 M390T probably benign Het
Fem1c A G 18: 46,524,485 L54P probably damaging Het
Fntb T A 12: 76,910,233 M282K probably benign Het
Gm11099 G A 2: 58,859,470 probably benign Het
Gm1527 T C 3: 28,926,556 S602P probably benign Het
Gm20388 A G 8: 122,269,584 probably benign Het
Gm5478 T A 15: 101,644,645 I331F probably damaging Het
Gm7853 C A 14: 36,089,583 noncoding transcript Het
Gsta2 A T 9: 78,341,865 C18S probably benign Het
H1foo T C 6: 115,947,740 V69A possibly damaging Het
Hecw1 T C 13: 14,306,086 E465G probably damaging Het
Herc1 A G 9: 66,508,266 D4841G probably damaging Het
Hus1b A G 13: 30,947,001 V225A probably benign Het
Keg1 A T 19: 12,716,023 M137L probably benign Het
Kmt2a C T 9: 44,824,635 probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mga T A 2: 119,941,675 V1672E probably damaging Het
Mios T C 6: 8,234,237 S803P probably benign Het
Mkl1 T C 15: 81,018,208 probably benign Het
Msh4 A T 3: 153,863,384 Y851N probably damaging Het
Mybl1 A C 1: 9,672,661 probably null Het
Myo5c A G 9: 75,275,939 Y865C probably damaging Het
Naip1 T C 13: 100,426,870 S596G probably benign Het
Nek5 G T 8: 22,096,731 Q355K possibly damaging Het
Nphp3 G T 9: 104,025,927 R701L possibly damaging Het
Olfr1006 T A 2: 85,674,918 T78S possibly damaging Het
Olfr1023 T A 2: 85,887,248 Y149* probably null Het
Olfr1052 T C 2: 86,298,479 I221T probably damaging Het
Olfr1094 T C 2: 86,829,198 S149P probably benign Het
Olfr666 A T 7: 104,893,237 Y130* probably null Het
Palm A G 10: 79,815,187 N149D possibly damaging Het
Pot1b T C 17: 55,653,451 I626M possibly damaging Het
Ptprt T A 2: 161,927,484 D487V probably damaging Het
Qpct A G 17: 79,070,772 I124V probably benign Het
Rbm12b1 T A 4: 12,145,817 D596E possibly damaging Het
Rnf157 A G 11: 116,354,759 C277R probably damaging Het
Rnf169 A G 7: 99,925,328 S687P possibly damaging Het
Sfxn1 T A 13: 54,092,450 probably null Het
Slc6a21 T C 7: 45,272,628 V649A probably benign Het
Slit3 A T 11: 35,686,299 T1120S probably damaging Het
Spem2 A T 11: 69,818,070 M58K probably benign Het
Sprr2k T A 3: 92,433,396 probably benign Het
Sspo T C 6: 48,463,400 probably null Het
Sv2b A T 7: 75,120,043 F584I possibly damaging Het
Tkfc A T 19: 10,595,326 M317K probably null Het
Tnni3k C T 3: 155,030,305 G134S probably benign Het
Ttn C T 2: 76,739,780 R26923H probably damaging Het
Tuba3b T C 6: 145,618,453 V75A possibly damaging Het
Unc79 T C 12: 103,183,525 L2626P probably damaging Het
Usp24 A T 4: 106,361,933 I491F probably damaging Het
V1ra8 A T 6: 90,203,150 I112F probably damaging Het
Vmn1r29 T G 6: 58,307,678 F128V probably benign Het
Zfp157 T A 5: 138,455,095 probably null Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1641:Csmd2 UTSW 4 128483395 missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 intron probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4489:Csmd2 UTSW 4 128381945 missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128480095 splice site probably null
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4649:Csmd2 UTSW 4 128546073 missense probably benign
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5410:Csmd2 UTSW 4 128548819 missense probably benign
R5551:Csmd2 UTSW 4 128510948 missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128551988 missense probably benign 0.01
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6129:Csmd2 UTSW 4 128493334 missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6724:Csmd2 UTSW 4 128563371 missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6868:Csmd2 UTSW 4 128442840 missense probably benign
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7096:Csmd2 UTSW 4 128462726 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
Predicted Primers PCR Primer
(F):5'- TTGAACTTCTCCACGGAGCCCAAC -3'
(R):5'- GGCACAAACTGGGCATACCTTAGC -3'

Sequencing Primer
(F):5'- ACCACGACTTCTTAGAAATCCG -3'
(R):5'- ATACCTTAGCTGTCTGTCAAACTGG -3'
Posted On2014-03-28