Incidental Mutation 'R1476:Cttnbp2'
ID164056
Institutional Source Beutler Lab
Gene Symbol Cttnbp2
Ensembl Gene ENSMUSG00000000416
Gene Namecortactin binding protein 2
Synonyms4732477G22Rik, 3010022N24Rik, Cortbp2, ORF4, 9130022E09Rik
MMRRC Submission 039529-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R1476 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location18366478-18514843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18434221 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 546 (K546R)
Ref Sequence ENSEMBL: ENSMUSP00000118432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090601] [ENSMUST00000129669] [ENSMUST00000148602]
Predicted Effect probably damaging
Transcript: ENSMUST00000090601
AA Change: K546R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088089
Gene: ENSMUSG00000000416
AA Change: K546R

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:CortBP2 32 138 3.1e-34 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
ANK 699 729 5.21e1 SMART
ANK 733 762 7.02e-5 SMART
ANK 766 795 6.55e-5 SMART
ANK 799 828 4.1e-6 SMART
ANK 832 861 1.09e-1 SMART
ANK 901 931 4.43e-2 SMART
Blast:AAA 1108 1285 1e-18 BLAST
low complexity region 1609 1623 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129669
SMART Domains Protein: ENSMUSP00000116878
Gene: ENSMUSG00000000416

DomainStartEndE-ValueType
Pfam:CortBP2 1 100 4.6e-44 PFAM
Pfam:CortBP2 92 138 3.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139557
Predicted Effect probably damaging
Transcript: ENSMUST00000146775
AA Change: K77R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119383
Gene: ENSMUSG00000000416
AA Change: K77R

DomainStartEndE-ValueType
low complexity region 71 79 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
ANK 190 220 5.21e1 SMART
ANK 224 253 7.02e-5 SMART
ANK 257 286 6.55e-5 SMART
ANK 290 319 4.1e-6 SMART
ANK 323 352 1.09e-1 SMART
ANK 392 422 4.43e-2 SMART
Blast:AAA 599 776 1e-18 BLAST
low complexity region 1100 1114 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000148602
AA Change: K546R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118432
Gene: ENSMUSG00000000416
AA Change: K546R

DomainStartEndE-ValueType
Pfam:CortBP2 26 138 4.3e-50 PFAM
Pfam:CortBP2 134 180 1.3e-12 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202396
Meta Mutation Damage Score 0.33 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 95% (80/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with six ankyrin repeats and several proline-rich regions. A similar gene in rat interacts with a central regulator of the actin cytoskeleton. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,702 probably benign Het
4932431P20Rik A G 7: 29,534,890 noncoding transcript Het
A730015C16Rik G A 4: 108,848,008 V40M probably damaging Het
Abcg2 A G 6: 58,678,337 D419G probably benign Het
Adamts17 A C 7: 67,075,343 E777A probably damaging Het
Ak1 A G 2: 32,633,466 K166R probably benign Het
Ankrd12 T C 17: 65,986,305 K711R probably damaging Het
Ate1 A T 7: 130,418,571 probably null Het
Atp5a1 A G 18: 77,781,925 H519R probably benign Het
Best1 G T 19: 9,990,489 Y284* probably null Het
C2cd6 A G 1: 59,076,728 probably benign Het
Casz1 G T 4: 148,946,171 V1216L probably benign Het
Cdc42bpg A G 19: 6,313,782 D493G probably damaging Het
Ces2f A G 8: 104,952,502 D317G possibly damaging Het
Chst15 A T 7: 132,270,273 M93K possibly damaging Het
Cntnap5a T C 1: 115,901,020 L58P probably damaging Het
Crip3 T C 17: 46,430,776 probably benign Het
Csmd2 G A 4: 128,487,001 E2117K probably benign Het
Cstf3 A G 2: 104,648,219 D212G possibly damaging Het
Cubn A G 2: 13,476,120 I308T probably benign Het
Cxcl9 T A 5: 92,325,113 D75V probably damaging Het
Dcdc5 C T 2: 106,358,632 noncoding transcript Het
Defa30 C A 8: 21,134,736 T25K possibly damaging Het
Dock7 A T 4: 99,079,435 H239Q possibly damaging Het
Dpp4 A G 2: 62,347,901 V629A possibly damaging Het
Fam83a T C 15: 58,009,945 M390T probably benign Het
Fem1c A G 18: 46,524,485 L54P probably damaging Het
Fntb T A 12: 76,910,233 M282K probably benign Het
Gm11099 G A 2: 58,859,470 probably benign Het
Gm1527 T C 3: 28,926,556 S602P probably benign Het
Gm20388 A G 8: 122,269,584 probably benign Het
Gm5478 T A 15: 101,644,645 I331F probably damaging Het
Gm7853 C A 14: 36,089,583 noncoding transcript Het
Gsta2 A T 9: 78,341,865 C18S probably benign Het
H1foo T C 6: 115,947,740 V69A possibly damaging Het
Hecw1 T C 13: 14,306,086 E465G probably damaging Het
Herc1 A G 9: 66,508,266 D4841G probably damaging Het
Hus1b A G 13: 30,947,001 V225A probably benign Het
Keg1 A T 19: 12,716,023 M137L probably benign Het
Kmt2a C T 9: 44,824,635 probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mga T A 2: 119,941,675 V1672E probably damaging Het
Mios T C 6: 8,234,237 S803P probably benign Het
Mkl1 T C 15: 81,018,208 probably benign Het
Msh4 A T 3: 153,863,384 Y851N probably damaging Het
Mybl1 A C 1: 9,672,661 probably null Het
Myo5c A G 9: 75,275,939 Y865C probably damaging Het
Naip1 T C 13: 100,426,870 S596G probably benign Het
Nek5 G T 8: 22,096,731 Q355K possibly damaging Het
Nphp3 G T 9: 104,025,927 R701L possibly damaging Het
Olfr1006 T A 2: 85,674,918 T78S possibly damaging Het
Olfr1023 T A 2: 85,887,248 Y149* probably null Het
Olfr1052 T C 2: 86,298,479 I221T probably damaging Het
Olfr1094 T C 2: 86,829,198 S149P probably benign Het
Olfr666 A T 7: 104,893,237 Y130* probably null Het
Palm A G 10: 79,815,187 N149D possibly damaging Het
Pot1b T C 17: 55,653,451 I626M possibly damaging Het
Ptprt T A 2: 161,927,484 D487V probably damaging Het
Qpct A G 17: 79,070,772 I124V probably benign Het
Rbm12b1 T A 4: 12,145,817 D596E possibly damaging Het
Rnf157 A G 11: 116,354,759 C277R probably damaging Het
Rnf169 A G 7: 99,925,328 S687P possibly damaging Het
Sfxn1 T A 13: 54,092,450 probably null Het
Slc6a21 T C 7: 45,272,628 V649A probably benign Het
Slit3 A T 11: 35,686,299 T1120S probably damaging Het
Spem2 A T 11: 69,818,070 M58K probably benign Het
Sprr2k T A 3: 92,433,396 probably benign Het
Sspo T C 6: 48,463,400 probably null Het
Sv2b A T 7: 75,120,043 F584I possibly damaging Het
Tkfc A T 19: 10,595,326 M317K probably null Het
Tnni3k C T 3: 155,030,305 G134S probably benign Het
Ttn C T 2: 76,739,780 R26923H probably damaging Het
Tuba3b T C 6: 145,618,453 V75A possibly damaging Het
Unc79 T C 12: 103,183,525 L2626P probably damaging Het
Usp24 A T 4: 106,361,933 I491F probably damaging Het
V1ra8 A T 6: 90,203,150 I112F probably damaging Het
Vmn1r29 T G 6: 58,307,678 F128V probably benign Het
Zfp157 T A 5: 138,455,095 probably null Het
Other mutations in Cttnbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Cttnbp2 APN 6 18381062 missense possibly damaging 0.71
IGL01014:Cttnbp2 APN 6 18423895 missense probably damaging 0.98
IGL01148:Cttnbp2 APN 6 18382818 missense probably damaging 1.00
IGL01903:Cttnbp2 APN 6 18501965 missense probably damaging 1.00
IGL01906:Cttnbp2 APN 6 18378376 nonsense probably null
IGL01994:Cttnbp2 APN 6 18420815 missense possibly damaging 0.77
IGL02212:Cttnbp2 APN 6 18382749 missense possibly damaging 0.78
IGL02696:Cttnbp2 APN 6 18434129 missense probably benign 0.01
IGL02813:Cttnbp2 APN 6 18367538 missense possibly damaging 0.94
IGL02864:Cttnbp2 APN 6 18374549 missense probably benign 0.21
IGL03309:Cttnbp2 APN 6 18381036 missense probably damaging 0.98
FR4304:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4449:Cttnbp2 UTSW 6 18367462 utr 3 prime probably benign
FR4548:Cttnbp2 UTSW 6 18367463 utr 3 prime probably benign
FR4589:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367461 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367467 utr 3 prime probably benign
R0165:Cttnbp2 UTSW 6 18435410 nonsense probably null
R0382:Cttnbp2 UTSW 6 18435343 missense probably benign 0.39
R0464:Cttnbp2 UTSW 6 18408691 missense possibly damaging 0.81
R0550:Cttnbp2 UTSW 6 18435309 missense possibly damaging 0.89
R0571:Cttnbp2 UTSW 6 18381103 missense probably benign
R0627:Cttnbp2 UTSW 6 18367373 makesense probably null
R0788:Cttnbp2 UTSW 6 18423835 missense probably damaging 1.00
R0826:Cttnbp2 UTSW 6 18405178 splice site probably benign
R1319:Cttnbp2 UTSW 6 18434630 missense probably benign 0.00
R1572:Cttnbp2 UTSW 6 18375975 missense possibly damaging 0.68
R1596:Cttnbp2 UTSW 6 18408592 missense probably damaging 1.00
R1607:Cttnbp2 UTSW 6 18435433 missense probably damaging 1.00
R1633:Cttnbp2 UTSW 6 18435167 missense probably damaging 1.00
R1634:Cttnbp2 UTSW 6 18408657 missense probably benign 0.39
R1661:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1665:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1834:Cttnbp2 UTSW 6 18501966 missense probably damaging 1.00
R1853:Cttnbp2 UTSW 6 18408602 missense probably benign 0.00
R1855:Cttnbp2 UTSW 6 18378413 missense probably benign
R2018:Cttnbp2 UTSW 6 18434518 missense probably damaging 1.00
R2169:Cttnbp2 UTSW 6 18426097 missense probably benign 0.00
R2175:Cttnbp2 UTSW 6 18434829 unclassified probably null
R2202:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2203:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2204:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2205:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2371:Cttnbp2 UTSW 6 18380604 missense possibly damaging 0.69
R2416:Cttnbp2 UTSW 6 18448286 missense probably damaging 0.99
R3414:Cttnbp2 UTSW 6 18389205 missense probably benign
R3617:Cttnbp2 UTSW 6 18414190 missense probably damaging 1.00
R3861:Cttnbp2 UTSW 6 18423833 missense probably benign 0.11
R3862:Cttnbp2 UTSW 6 18434906 missense probably benign 0.02
R3940:Cttnbp2 UTSW 6 18420975 missense probably benign 0.34
R3941:Cttnbp2 UTSW 6 18427453 missense probably benign 0.11
R4097:Cttnbp2 UTSW 6 18420872 missense probably benign
R4211:Cttnbp2 UTSW 6 18427543 missense probably damaging 1.00
R4353:Cttnbp2 UTSW 6 18514704 missense probably benign 0.00
R4367:Cttnbp2 UTSW 6 18405249 missense probably damaging 1.00
R4651:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4652:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4660:Cttnbp2 UTSW 6 18406537 missense probably benign 0.05
R4975:Cttnbp2 UTSW 6 18406526 missense possibly damaging 0.91
R5064:Cttnbp2 UTSW 6 18448279 missense probably damaging 1.00
R5205:Cttnbp2 UTSW 6 18427433 splice site probably benign
R5305:Cttnbp2 UTSW 6 18381098 missense probably benign
R5484:Cttnbp2 UTSW 6 18427690 intron probably benign
R5629:Cttnbp2 UTSW 6 18405218 missense probably damaging 1.00
R5763:Cttnbp2 UTSW 6 18414299 missense probably benign 0.00
R5766:Cttnbp2 UTSW 6 18381033 missense possibly damaging 0.87
R5942:Cttnbp2 UTSW 6 18448440 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18434233 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18448369 missense probably benign 0.01
R6163:Cttnbp2 UTSW 6 18434951 missense possibly damaging 0.91
R6545:Cttnbp2 UTSW 6 18405279 intron probably null
R6858:Cttnbp2 UTSW 6 18448453 missense probably damaging 1.00
R7037:Cttnbp2 UTSW 6 18435118 missense probably damaging 1.00
R7135:Cttnbp2 UTSW 6 18448447 missense not run
R7141:Cttnbp2 UTSW 6 18380468 missense not run
Predicted Primers PCR Primer
(F):5'- ACAAGGGAGCTGTCTGAACATGC -3'
(R):5'- CTGTCCAGATTTACCAGCCCTCAAG -3'

Sequencing Primer
(F):5'- TGCAGGTGCCACAGTTAAATC -3'
(R):5'- AGCGGGTGCTTCTTCAAGAC -3'
Posted On2014-03-28