Incidental Mutation 'R1477:Zfp790'
ID164125
Institutional Source Beutler Lab
Gene Symbol Zfp790
Ensembl Gene ENSMUSG00000011427
Gene Namezinc finger protein 790
Synonyms6330581L23Rik
MMRRC Submission 039530-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R1477 (G1)
Quality Score215
Status Not validated
Chromosome7
Chromosomal Location29816114-29831005 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to T at 29823100 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032796] [ENSMUST00000178162] [ENSMUST00000207328]
Predicted Effect probably benign
Transcript: ENSMUST00000032796
SMART Domains Protein: ENSMUSP00000032796
Gene: ENSMUSG00000011427

DomainStartEndE-ValueType
KRAB 5 65 3e-27 SMART
ZnF_C2H2 224 246 2.95e-3 SMART
ZnF_C2H2 252 274 2.53e-2 SMART
ZnF_C2H2 280 302 5.5e-3 SMART
ZnF_C2H2 308 330 2.75e-3 SMART
ZnF_C2H2 336 358 2.12e-4 SMART
ZnF_C2H2 364 386 1.03e-2 SMART
Pfam:zf-C2H2_6 391 403 2.4e-1 PFAM
ZnF_C2H2 448 470 9.56e1 SMART
ZnF_C2H2 476 498 7.26e-3 SMART
ZnF_C2H2 504 526 2.57e-3 SMART
ZnF_C2H2 532 554 6.42e-4 SMART
ZnF_C2H2 640 662 1.12e-3 SMART
ZnF_C2H2 668 690 2.12e-4 SMART
ZnF_C2H2 696 718 1.98e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178162
SMART Domains Protein: ENSMUSP00000136932
Gene: ENSMUSG00000011427

DomainStartEndE-ValueType
KRAB 5 65 3e-27 SMART
ZnF_C2H2 224 246 2.95e-3 SMART
ZnF_C2H2 252 274 2.53e-2 SMART
ZnF_C2H2 280 302 5.5e-3 SMART
ZnF_C2H2 308 330 2.75e-3 SMART
ZnF_C2H2 336 358 2.12e-4 SMART
ZnF_C2H2 364 386 1.03e-2 SMART
ZnF_C2H2 448 470 9.56e1 SMART
ZnF_C2H2 476 498 7.26e-3 SMART
ZnF_C2H2 504 526 2.57e-3 SMART
ZnF_C2H2 532 554 6.42e-4 SMART
ZnF_C2H2 640 662 1.12e-3 SMART
ZnF_C2H2 668 690 2.12e-4 SMART
ZnF_C2H2 696 718 1.98e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207328
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C A 7: 28,157,093 Q2102K probably benign Het
Acsl5 A C 19: 55,291,472 D481A probably benign Het
Adam2 A C 14: 66,077,700 L8R possibly damaging Het
Arfgef1 A T 1: 10,189,284 C619S probably damaging Het
Atm A G 9: 53,464,273 I2082T probably benign Het
Cgrrf1 A G 14: 46,853,438 I210M probably benign Het
Clec2e A T 6: 129,095,200 V72E probably benign Het
Cmtr1 T C 17: 29,697,157 V587A possibly damaging Het
Col1a2 T C 6: 4,539,673 F1314L unknown Het
Ctbp2 T C 7: 132,998,941 E618G probably damaging Het
Dock8 A T 19: 25,095,550 Y398F possibly damaging Het
Ezh1 A T 11: 101,192,984 D733E probably damaging Het
Fbxl6 A G 15: 76,537,734 S202P probably benign Het
Gm996 G C 2: 25,579,753 H49D possibly damaging Het
Grid2ip G A 5: 143,375,585 A191T probably damaging Het
Helz2 T C 2: 181,232,804 S1966G probably benign Het
Ipmk A G 10: 71,381,777 K385E probably damaging Het
Itga11 G A 9: 62,755,211 V489I probably benign Het
Klhl6 T C 16: 19,965,977 K137R probably benign Het
Meis1 G A 11: 18,881,665 Q458* probably null Het
Mst1r T C 9: 107,908,324 S394P probably benign Het
Mus81 G T 19: 5,486,334 H155Q probably benign Het
Neb G A 2: 52,264,122 L2326F probably damaging Het
Nf1 C T 11: 79,395,859 Q162* probably null Het
Nin T C 12: 70,044,184 E819G possibly damaging Het
Nox4 T C 7: 87,295,866 V79A probably benign Het
Olfr212 A T 6: 116,516,665 Y296F probably damaging Het
Olfr291 T A 7: 84,857,017 I216N probably damaging Het
Olfr61 T A 7: 140,638,442 I247N possibly damaging Het
Olfr744 A T 14: 50,618,713 I164F probably damaging Het
Peg3 T A 7: 6,716,142 D69V probably damaging Het
Pih1d3 G A 1: 31,223,023 V29M probably benign Het
Pnp2 A G 14: 50,959,535 E26G probably benign Het
Pnpt1 T A 11: 29,137,102 C154S probably benign Het
Ppp1r26 C T 2: 28,452,788 T810I probably benign Het
Ppp2r5b A G 19: 6,230,227 S349P probably benign Het
Prdm4 C T 10: 85,904,265 V424I probably benign Het
Rraga A G 4: 86,576,759 I281V probably benign Het
Sall1 T C 8: 89,032,882 E198G probably damaging Het
Serpina9 T C 12: 103,997,103 D382G possibly damaging Het
Stt3b A G 9: 115,266,192 V257A probably damaging Het
Taf2 A T 15: 55,062,172 Y225N possibly damaging Het
Tlr3 A G 8: 45,398,165 L41P probably damaging Het
Trappc12 A T 12: 28,737,752 V444E probably benign Het
Trim34a T A 7: 104,248,080 V117D possibly damaging Het
Ttbk1 A C 17: 46,476,799 M259R probably benign Het
Ttll12 A G 15: 83,580,102 V509A probably damaging Het
Ush2a G A 1: 188,849,076 V3718M probably benign Het
Vps35 T A 8: 85,287,800 E73D probably damaging Het
Other mutations in Zfp790
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Zfp790 APN 7 29828563 missense probably benign 0.32
IGL00979:Zfp790 APN 7 29829609 missense probably benign 0.00
IGL02286:Zfp790 APN 7 29829735 missense possibly damaging 0.53
IGL03136:Zfp790 APN 7 29829895 nonsense probably null
R0021:Zfp790 UTSW 7 29825688 unclassified probably benign
R0077:Zfp790 UTSW 7 29824875 missense probably damaging 0.98
R1572:Zfp790 UTSW 7 29828139 missense probably benign 0.33
R2015:Zfp790 UTSW 7 29828861 missense probably benign 0.29
R4941:Zfp790 UTSW 7 29829491 missense possibly damaging 0.83
R5019:Zfp790 UTSW 7 29829767 missense probably benign 0.00
R5159:Zfp790 UTSW 7 29829767 missense probably benign 0.00
R5160:Zfp790 UTSW 7 29829767 missense probably benign 0.00
R5722:Zfp790 UTSW 7 29830089 nonsense probably null
R5954:Zfp790 UTSW 7 29829504 missense probably damaging 1.00
R6025:Zfp790 UTSW 7 29829545 missense possibly damaging 0.71
R6312:Zfp790 UTSW 7 29828222 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAGAGTTCCATTCCCTGTGAAGA -3'
(R):5'- CGTGTGGGAGACATAAGGGTCTACT -3'

Sequencing Primer
(F):5'- gcctgcctctgctcctg -3'
(R):5'- TCTACTAACAGAAGAAAGAGCGCC -3'
Posted On2014-03-28