Incidental Mutation 'R1477:Nox4'
ID164127
Institutional Source Beutler Lab
Gene Symbol Nox4
Ensembl Gene ENSMUSG00000030562
Gene NameNADPH oxidase 4
Synonyms
MMRRC Submission 039530-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1477 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location87246096-87398710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87295866 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 79 (V79A)
Ref Sequence ENSEMBL: ENSMUSP00000070039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032781] [ENSMUST00000068829] [ENSMUST00000124057] [ENSMUST00000126887] [ENSMUST00000136577] [ENSMUST00000144267]
Predicted Effect probably benign
Transcript: ENSMUST00000032781
AA Change: V79A

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000032781
Gene: ENSMUSG00000030562
AA Change: V79A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 58 205 8.3e-21 PFAM
Pfam:FAD_binding_8 306 417 2.8e-17 PFAM
Pfam:NAD_binding_6 423 561 7.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068829
AA Change: V79A

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000070039
Gene: ENSMUSG00000030562
AA Change: V79A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 58 205 5.3e-27 PFAM
Pfam:FAD_binding_8 306 417 5.5e-17 PFAM
Pfam:NAD_binding_6 423 539 4.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124057
AA Change: V110A

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000119365
Gene: ENSMUSG00000030562
AA Change: V110A

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 134 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126887
SMART Domains Protein: ENSMUSP00000138336
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127138
Predicted Effect probably benign
Transcript: ENSMUST00000136577
SMART Domains Protein: ENSMUSP00000138274
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144267
SMART Domains Protein: ENSMUSP00000138143
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a null allele display increased heart damage following pressure overload. Mice with a cardiomyocyte specific deletion show decreased damage following pressure overload. Mice homozygous for a different knock-out allele exhibit decreased suseptibility to bleomycin-induced fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C A 7: 28,157,093 Q2102K probably benign Het
Acsl5 A C 19: 55,291,472 D481A probably benign Het
Adam2 A C 14: 66,077,700 L8R possibly damaging Het
Arfgef1 A T 1: 10,189,284 C619S probably damaging Het
Atm A G 9: 53,464,273 I2082T probably benign Het
Cgrrf1 A G 14: 46,853,438 I210M probably benign Het
Clec2e A T 6: 129,095,200 V72E probably benign Het
Cmtr1 T C 17: 29,697,157 V587A possibly damaging Het
Col1a2 T C 6: 4,539,673 F1314L unknown Het
Ctbp2 T C 7: 132,998,941 E618G probably damaging Het
Dock8 A T 19: 25,095,550 Y398F possibly damaging Het
Ezh1 A T 11: 101,192,984 D733E probably damaging Het
Fbxl6 A G 15: 76,537,734 S202P probably benign Het
Gm996 G C 2: 25,579,753 H49D possibly damaging Het
Grid2ip G A 5: 143,375,585 A191T probably damaging Het
Helz2 T C 2: 181,232,804 S1966G probably benign Het
Ipmk A G 10: 71,381,777 K385E probably damaging Het
Itga11 G A 9: 62,755,211 V489I probably benign Het
Klhl6 T C 16: 19,965,977 K137R probably benign Het
Meis1 G A 11: 18,881,665 Q458* probably null Het
Mst1r T C 9: 107,908,324 S394P probably benign Het
Mus81 G T 19: 5,486,334 H155Q probably benign Het
Neb G A 2: 52,264,122 L2326F probably damaging Het
Nf1 C T 11: 79,395,859 Q162* probably null Het
Nin T C 12: 70,044,184 E819G possibly damaging Het
Olfr212 A T 6: 116,516,665 Y296F probably damaging Het
Olfr291 T A 7: 84,857,017 I216N probably damaging Het
Olfr61 T A 7: 140,638,442 I247N possibly damaging Het
Olfr744 A T 14: 50,618,713 I164F probably damaging Het
Peg3 T A 7: 6,716,142 D69V probably damaging Het
Pih1d3 G A 1: 31,223,023 V29M probably benign Het
Pnp2 A G 14: 50,959,535 E26G probably benign Het
Pnpt1 T A 11: 29,137,102 C154S probably benign Het
Ppp1r26 C T 2: 28,452,788 T810I probably benign Het
Ppp2r5b A G 19: 6,230,227 S349P probably benign Het
Prdm4 C T 10: 85,904,265 V424I probably benign Het
Rraga A G 4: 86,576,759 I281V probably benign Het
Sall1 T C 8: 89,032,882 E198G probably damaging Het
Serpina9 T C 12: 103,997,103 D382G possibly damaging Het
Stt3b A G 9: 115,266,192 V257A probably damaging Het
Taf2 A T 15: 55,062,172 Y225N possibly damaging Het
Tlr3 A G 8: 45,398,165 L41P probably damaging Het
Trappc12 A T 12: 28,737,752 V444E probably benign Het
Trim34a T A 7: 104,248,080 V117D possibly damaging Het
Ttbk1 A C 17: 46,476,799 M259R probably benign Het
Ttll12 A G 15: 83,580,102 V509A probably damaging Het
Ush2a G A 1: 188,849,076 V3718M probably benign Het
Vps35 T A 8: 85,287,800 E73D probably damaging Het
Zfp790 C T 7: 29,823,100 probably benign Het
Other mutations in Nox4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Nox4 APN 7 87376216 missense possibly damaging 0.89
IGL02711:Nox4 APN 7 87396868 missense probably damaging 1.00
IGL03234:Nox4 APN 7 87317313 critical splice donor site probably null
IGL03286:Nox4 APN 7 87370141 splice site probably benign
LCD18:Nox4 UTSW 7 87243067 unclassified probably benign
PIT4151001:Nox4 UTSW 7 87304889 missense probably benign 0.02
R0717:Nox4 UTSW 7 87304890 nonsense probably null
R1033:Nox4 UTSW 7 87374413 missense probably damaging 0.99
R1135:Nox4 UTSW 7 87323789 missense probably damaging 1.00
R1333:Nox4 UTSW 7 87246864 missense possibly damaging 0.80
R1489:Nox4 UTSW 7 87304889 missense probably damaging 0.99
R1579:Nox4 UTSW 7 87370023 missense probably damaging 0.98
R1669:Nox4 UTSW 7 87295889 missense probably benign 0.01
R1742:Nox4 UTSW 7 87295818 missense possibly damaging 0.82
R1900:Nox4 UTSW 7 87360796 nonsense probably null
R2112:Nox4 UTSW 7 87372008 missense probably damaging 1.00
R2192:Nox4 UTSW 7 87374380 missense probably benign 0.02
R2496:Nox4 UTSW 7 87306750 missense probably benign 0.04
R2497:Nox4 UTSW 7 87295876 nonsense probably null
R4158:Nox4 UTSW 7 87396824 missense possibly damaging 0.95
R4160:Nox4 UTSW 7 87396824 missense possibly damaging 0.95
R4281:Nox4 UTSW 7 87297524 missense possibly damaging 0.77
R4685:Nox4 UTSW 7 87297508 missense probably benign 0.36
R4791:Nox4 UTSW 7 87304847 missense probably benign 0.35
R5001:Nox4 UTSW 7 87360803 missense probably damaging 0.96
R5091:Nox4 UTSW 7 87376242 missense probably damaging 1.00
R5174:Nox4 UTSW 7 87323766 missense probably benign 0.10
R5220:Nox4 UTSW 7 87374408 missense possibly damaging 0.91
R5278:Nox4 UTSW 7 87371926 missense probably damaging 1.00
R5723:Nox4 UTSW 7 87304973 intron probably benign
R5840:Nox4 UTSW 7 87360793 missense probably benign 0.00
R5852:Nox4 UTSW 7 87338964 missense probably damaging 0.98
X0021:Nox4 UTSW 7 87395678 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGACCACAGGCTGCTTTTCC -3'
(R):5'- AGAACACAGTCCTCTGGCTTGCTC -3'

Sequencing Primer
(F):5'- AGGCTGCTTTTCCTTTGTACTTG -3'
(R):5'- ggtcacattttccataccccag -3'
Posted On2014-03-28