Incidental Mutation 'R1477:Vps35'
ID164132
Institutional Source Beutler Lab
Gene Symbol Vps35
Ensembl Gene ENSMUSG00000031696
Gene NameVPS35 retromer complex component
SynonymsMem3
MMRRC Submission 039530-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1477 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location85260392-85299802 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85287800 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 73 (E73D)
Ref Sequence ENSEMBL: ENSMUSP00000034131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034131]
Predicted Effect probably damaging
Transcript: ENSMUST00000034131
AA Change: E73D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034131
Gene: ENSMUSG00000031696
AA Change: E73D

DomainStartEndE-ValueType
Pfam:Vps35 15 753 6.8e-303 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211479
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of vacuolar protein sorting (VPS) genes. The encoded protein is a component of a large multimeric complex, termed the retromer complex, involved in retrograde transport of proteins from endosomes to the trans-Golgi network. The close structural similarity between the yeast and human proteins that make up this complex suggests a similarity in function. Expression studies in yeast and mammalian cells indicate that this protein interacts directly with VPS35, which serves as the core of the retromer complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C A 7: 28,157,093 Q2102K probably benign Het
Acsl5 A C 19: 55,291,472 D481A probably benign Het
Adam2 A C 14: 66,077,700 L8R possibly damaging Het
Arfgef1 A T 1: 10,189,284 C619S probably damaging Het
Atm A G 9: 53,464,273 I2082T probably benign Het
Cgrrf1 A G 14: 46,853,438 I210M probably benign Het
Clec2e A T 6: 129,095,200 V72E probably benign Het
Cmtr1 T C 17: 29,697,157 V587A possibly damaging Het
Col1a2 T C 6: 4,539,673 F1314L unknown Het
Ctbp2 T C 7: 132,998,941 E618G probably damaging Het
Dock8 A T 19: 25,095,550 Y398F possibly damaging Het
Ezh1 A T 11: 101,192,984 D733E probably damaging Het
Fbxl6 A G 15: 76,537,734 S202P probably benign Het
Gm996 G C 2: 25,579,753 H49D possibly damaging Het
Grid2ip G A 5: 143,375,585 A191T probably damaging Het
Helz2 T C 2: 181,232,804 S1966G probably benign Het
Ipmk A G 10: 71,381,777 K385E probably damaging Het
Itga11 G A 9: 62,755,211 V489I probably benign Het
Klhl6 T C 16: 19,965,977 K137R probably benign Het
Meis1 G A 11: 18,881,665 Q458* probably null Het
Mst1r T C 9: 107,908,324 S394P probably benign Het
Mus81 G T 19: 5,486,334 H155Q probably benign Het
Neb G A 2: 52,264,122 L2326F probably damaging Het
Nf1 C T 11: 79,395,859 Q162* probably null Het
Nin T C 12: 70,044,184 E819G possibly damaging Het
Nox4 T C 7: 87,295,866 V79A probably benign Het
Olfr212 A T 6: 116,516,665 Y296F probably damaging Het
Olfr291 T A 7: 84,857,017 I216N probably damaging Het
Olfr61 T A 7: 140,638,442 I247N possibly damaging Het
Olfr744 A T 14: 50,618,713 I164F probably damaging Het
Peg3 T A 7: 6,716,142 D69V probably damaging Het
Pih1d3 G A 1: 31,223,023 V29M probably benign Het
Pnp2 A G 14: 50,959,535 E26G probably benign Het
Pnpt1 T A 11: 29,137,102 C154S probably benign Het
Ppp1r26 C T 2: 28,452,788 T810I probably benign Het
Ppp2r5b A G 19: 6,230,227 S349P probably benign Het
Prdm4 C T 10: 85,904,265 V424I probably benign Het
Rraga A G 4: 86,576,759 I281V probably benign Het
Sall1 T C 8: 89,032,882 E198G probably damaging Het
Serpina9 T C 12: 103,997,103 D382G possibly damaging Het
Stt3b A G 9: 115,266,192 V257A probably damaging Het
Taf2 A T 15: 55,062,172 Y225N possibly damaging Het
Tlr3 A G 8: 45,398,165 L41P probably damaging Het
Trappc12 A T 12: 28,737,752 V444E probably benign Het
Trim34a T A 7: 104,248,080 V117D possibly damaging Het
Ttbk1 A C 17: 46,476,799 M259R probably benign Het
Ttll12 A G 15: 83,580,102 V509A probably damaging Het
Ush2a G A 1: 188,849,076 V3718M probably benign Het
Zfp790 C T 7: 29,823,100 probably benign Het
Other mutations in Vps35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Vps35 APN 8 85273463 splice site probably benign
IGL02604:Vps35 APN 8 85286389 missense probably damaging 1.00
IGL03278:Vps35 APN 8 85294961 unclassified probably benign
IGL03326:Vps35 APN 8 85274897 nonsense probably null
R0118:Vps35 UTSW 8 85294953 missense probably benign 0.04
R0226:Vps35 UTSW 8 85273575 missense probably damaging 0.97
R1079:Vps35 UTSW 8 85279054 missense probably damaging 1.00
R1969:Vps35 UTSW 8 85278994 missense possibly damaging 0.90
R2082:Vps35 UTSW 8 85263465 missense possibly damaging 0.95
R2156:Vps35 UTSW 8 85286500 missense probably benign 0.06
R2341:Vps35 UTSW 8 85274814 splice site probably benign
R3752:Vps35 UTSW 8 85274831 missense probably benign 0.34
R4589:Vps35 UTSW 8 85287702 missense probably damaging 1.00
R4745:Vps35 UTSW 8 85261262 missense probably benign
R4790:Vps35 UTSW 8 85278857 splice site probably null
R4827:Vps35 UTSW 8 85273557 missense possibly damaging 0.94
R4953:Vps35 UTSW 8 85281846 missense probably damaging 1.00
R6277:Vps35 UTSW 8 85261228 missense possibly damaging 0.80
R6291:Vps35 UTSW 8 85299457 start codon destroyed probably benign 0.07
R6434:Vps35 UTSW 8 85273495 missense possibly damaging 0.53
X0020:Vps35 UTSW 8 85263421 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGTTGCTTGTGGAAATTGCTACTC -3'
(R):5'- ACTGAGCTAGATCACTAGCCCTGAC -3'

Sequencing Primer
(F):5'- gcctgcctcttaaataaagcc -3'
(R):5'- gctagatcactagcccTGACTAAAAG -3'
Posted On2014-03-28