Incidental Mutation 'R1477:Acsl5'
ID164163
Institutional Source Beutler Lab
Gene Symbol Acsl5
Ensembl Gene ENSMUSG00000024981
Gene Nameacyl-CoA synthetase long-chain family member 5
SynonymsFacl5, 1700030F05Rik
MMRRC Submission 039530-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R1477 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location55251938-55297720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 55291472 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 481 (D481A)
Ref Sequence ENSEMBL: ENSMUSP00000046585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043150] [ENSMUST00000225963] [ENSMUST00000226103]
Predicted Effect probably benign
Transcript: ENSMUST00000043150
AA Change: D481A

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000046585
Gene: ENSMUSG00000024981
AA Change: D481A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:AMP-binding 82 548 2.7e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224414
Predicted Effect probably benign
Transcript: ENSMUST00000225963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226019
Predicted Effect probably benign
Transcript: ENSMUST00000226103
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme is highly expressed in uterus and spleen, and in trace amounts in normal brain, but has markedly increased levels in malignant gliomas. This gene functions in mediating fatty acid-induced glioma cell growth. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit decreased mean bone mineral content and density measurements when compared with controls. A notably decreased mean platelet count is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C A 7: 28,157,093 Q2102K probably benign Het
Adam2 A C 14: 66,077,700 L8R possibly damaging Het
Arfgef1 A T 1: 10,189,284 C619S probably damaging Het
Atm A G 9: 53,464,273 I2082T probably benign Het
Cgrrf1 A G 14: 46,853,438 I210M probably benign Het
Clec2e A T 6: 129,095,200 V72E probably benign Het
Cmtr1 T C 17: 29,697,157 V587A possibly damaging Het
Col1a2 T C 6: 4,539,673 F1314L unknown Het
Ctbp2 T C 7: 132,998,941 E618G probably damaging Het
Dock8 A T 19: 25,095,550 Y398F possibly damaging Het
Ezh1 A T 11: 101,192,984 D733E probably damaging Het
Fbxl6 A G 15: 76,537,734 S202P probably benign Het
Gm996 G C 2: 25,579,753 H49D possibly damaging Het
Grid2ip G A 5: 143,375,585 A191T probably damaging Het
Helz2 T C 2: 181,232,804 S1966G probably benign Het
Ipmk A G 10: 71,381,777 K385E probably damaging Het
Itga11 G A 9: 62,755,211 V489I probably benign Het
Klhl6 T C 16: 19,965,977 K137R probably benign Het
Meis1 G A 11: 18,881,665 Q458* probably null Het
Mst1r T C 9: 107,908,324 S394P probably benign Het
Mus81 G T 19: 5,486,334 H155Q probably benign Het
Neb G A 2: 52,264,122 L2326F probably damaging Het
Nf1 C T 11: 79,395,859 Q162* probably null Het
Nin T C 12: 70,044,184 E819G possibly damaging Het
Nox4 T C 7: 87,295,866 V79A probably benign Het
Olfr212 A T 6: 116,516,665 Y296F probably damaging Het
Olfr291 T A 7: 84,857,017 I216N probably damaging Het
Olfr61 T A 7: 140,638,442 I247N possibly damaging Het
Olfr744 A T 14: 50,618,713 I164F probably damaging Het
Peg3 T A 7: 6,716,142 D69V probably damaging Het
Pih1d3 G A 1: 31,223,023 V29M probably benign Het
Pnp2 A G 14: 50,959,535 E26G probably benign Het
Pnpt1 T A 11: 29,137,102 C154S probably benign Het
Ppp1r26 C T 2: 28,452,788 T810I probably benign Het
Ppp2r5b A G 19: 6,230,227 S349P probably benign Het
Prdm4 C T 10: 85,904,265 V424I probably benign Het
Rraga A G 4: 86,576,759 I281V probably benign Het
Sall1 T C 8: 89,032,882 E198G probably damaging Het
Serpina9 T C 12: 103,997,103 D382G possibly damaging Het
Stt3b A G 9: 115,266,192 V257A probably damaging Het
Taf2 A T 15: 55,062,172 Y225N possibly damaging Het
Tlr3 A G 8: 45,398,165 L41P probably damaging Het
Trappc12 A T 12: 28,737,752 V444E probably benign Het
Trim34a T A 7: 104,248,080 V117D possibly damaging Het
Ttbk1 A C 17: 46,476,799 M259R probably benign Het
Ttll12 A G 15: 83,580,102 V509A probably damaging Het
Ush2a G A 1: 188,849,076 V3718M probably benign Het
Vps35 T A 8: 85,287,800 E73D probably damaging Het
Zfp790 C T 7: 29,823,100 probably benign Het
Other mutations in Acsl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Acsl5 APN 19 55272833 missense probably benign 0.02
IGL02792:Acsl5 APN 19 55293731 critical splice donor site probably null
IGL02796:Acsl5 UTSW 19 55278169 nonsense probably null
R0206:Acsl5 UTSW 19 55280569 missense probably benign
R0400:Acsl5 UTSW 19 55293711 missense probably damaging 0.99
R0418:Acsl5 UTSW 19 55272806 missense probably benign 0.16
R0571:Acsl5 UTSW 19 55288911 intron probably benign
R0626:Acsl5 UTSW 19 55284472 missense probably benign 0.00
R0792:Acsl5 UTSW 19 55280492 missense probably benign 0.01
R1144:Acsl5 UTSW 19 55291843 missense probably damaging 1.00
R1522:Acsl5 UTSW 19 55280492 missense probably benign 0.01
R1927:Acsl5 UTSW 19 55278154 missense probably benign 0.37
R2495:Acsl5 UTSW 19 55293599 nonsense probably null
R4153:Acsl5 UTSW 19 55281463 missense probably benign 0.23
R4570:Acsl5 UTSW 19 55291774 missense probably damaging 0.99
R4721:Acsl5 UTSW 19 55280530 missense probably benign 0.00
R4834:Acsl5 UTSW 19 55280559 missense probably benign 0.00
R5270:Acsl5 UTSW 19 55294218 missense possibly damaging 0.50
R5360:Acsl5 UTSW 19 55291160 nonsense probably null
R5436:Acsl5 UTSW 19 55279565 critical splice donor site probably null
R5458:Acsl5 UTSW 19 55294230 missense probably damaging 1.00
R5479:Acsl5 UTSW 19 55280462 missense probably damaging 1.00
R5812:Acsl5 UTSW 19 55294836 missense probably benign 0.01
R6232:Acsl5 UTSW 19 55280501 missense possibly damaging 0.69
R6821:Acsl5 UTSW 19 55288836 missense probably benign 0.03
R6874:Acsl5 UTSW 19 55291863 missense probably damaging 1.00
X0013:Acsl5 UTSW 19 55293664 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATTACATCACCTGGGGACTGGAC -3'
(R):5'- TCGCCACTATAGGAAAATGCAGCTC -3'

Sequencing Primer
(F):5'- GAGAAGTCTTCTAGCTGACCC -3'
(R):5'- TGCAGCTCACTGATCTTATTATATTG -3'
Posted On2014-03-28