Incidental Mutation 'R1479:Hax1'
ID164181
Institutional Source Beutler Lab
Gene Symbol Hax1
Ensembl Gene ENSMUSG00000027944
Gene NameHCLS1 associated X-1
SynonymsHAX-1, Hs1bp1, HS1-associated protein X-1, Silg111, mHAX-1s
MMRRC Submission 039532-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R1479 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89995446-89998780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 89995857 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 212 (E212D)
Ref Sequence ENSEMBL: ENSMUSP00000143155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029553] [ENSMUST00000064639] [ENSMUST00000079724] [ENSMUST00000196843] [ENSMUST00000197432] [ENSMUST00000197725] [ENSMUST00000197767] [ENSMUST00000197786] [ENSMUST00000198322] [ENSMUST00000198782] [ENSMUST00000199050] [ENSMUST00000199163] [ENSMUST00000199740]
Predicted Effect probably benign
Transcript: ENSMUST00000029553
SMART Domains Protein: ENSMUSP00000029553
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064639
SMART Domains Protein: ENSMUSP00000066138
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 394 403 N/A INTRINSIC
low complexity region 405 414 N/A INTRINSIC
low complexity region 464 489 N/A INTRINSIC
Pfam:DUF3697 520 551 4.1e-18 PFAM
low complexity region 559 594 N/A INTRINSIC
low complexity region 670 680 N/A INTRINSIC
low complexity region 719 750 N/A INTRINSIC
low complexity region 753 809 N/A INTRINSIC
low complexity region 813 827 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1043 1056 N/A INTRINSIC
low complexity region 1077 1092 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079724
AA Change: E238D

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078661
Gene: ENSMUSG00000027944
AA Change: E238D

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
low complexity region 248 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196843
SMART Domains Protein: ENSMUSP00000143459
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
low complexity region 1072 1087 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197432
AA Change: E24D

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143136
Gene: ENSMUSG00000027944
AA Change: E24D

DomainStartEndE-ValueType
low complexity region 34 46 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197481
Predicted Effect possibly damaging
Transcript: ENSMUST00000197725
AA Change: E109D

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142741
Gene: ENSMUSG00000027944
AA Change: E109D

DomainStartEndE-ValueType
low complexity region 119 131 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197767
AA Change: E235D

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142445
Gene: ENSMUSG00000027944
AA Change: E235D

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
low complexity region 245 257 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197786
AA Change: E154D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142627
Gene: ENSMUSG00000027944
AA Change: E154D

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198322
SMART Domains Protein: ENSMUSP00000142524
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 369 378 N/A INTRINSIC
low complexity region 380 389 N/A INTRINSIC
low complexity region 439 464 N/A INTRINSIC
Pfam:DUF3697 494 526 4.1e-22 PFAM
low complexity region 534 569 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
low complexity region 694 725 N/A INTRINSIC
low complexity region 728 784 N/A INTRINSIC
low complexity region 788 802 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198782
AA Change: E212D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143155
Gene: ENSMUSG00000027944
AA Change: E212D

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199014
Predicted Effect probably benign
Transcript: ENSMUST00000199050
SMART Domains Protein: ENSMUSP00000142719
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199469
Predicted Effect probably benign
Transcript: ENSMUST00000199740
SMART Domains Protein: ENSMUSP00000143557
Gene: ENSMUSG00000027944

DomainStartEndE-ValueType
SCOP:d1qbkb_ 4 18 4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200257
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is known to associate with hematopoietic cell-specific Lyn substrate 1, a substrate of Src family tyrosine kinases. It also interacts with the product of the polycystic kidney disease 2 gene, mutations in which are associated with autosomal-dominant polycystic kidney disease, and with the F-actin-binding protein, cortactin. It was earlier thought that this gene product is mainly localized in the mitochondria, however, recent studies indicate it to be localized in the cell body. Mutations in this gene result in autosomal recessive severe congenital neutropenia, also known as Kostmann disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for deletion of this gene fail to survive beyond 14 weeks of age. Apoptosis of neurons in the striatum and cerebellum occurs as does loss of lymphocytes and neutrophiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,379,387 D138E probably damaging Het
1700022I11Rik A C 4: 42,972,543 K625N possibly damaging Het
2310030G06Rik T A 9: 50,741,301 T58S possibly damaging Het
4930432K21Rik C A 8: 84,162,397 T123K possibly damaging Het
Alox12e A G 11: 70,320,782 V252A probably benign Het
Anks6 T C 4: 47,044,874 D344G probably damaging Het
Atg14 A T 14: 47,547,239 probably null Het
BC052040 T A 2: 115,639,013 N74K probably benign Het
Bcr G T 10: 75,061,125 E34* probably null Het
Birc6 C T 17: 74,634,853 T2728M probably damaging Het
Bmp2k T A 5: 97,053,200 N326K probably benign Het
Ccdc188 A C 16: 18,219,290 T242P possibly damaging Het
Chsy3 A T 18: 59,408,913 E374D probably benign Het
Clca4b A T 3: 144,915,468 V615E probably damaging Het
Clcnka C A 4: 141,389,447 A498S possibly damaging Het
Csmd3 A G 15: 47,857,886 C1450R probably damaging Het
Cul7 C A 17: 46,651,747 D101E probably damaging Het
Cyp27b1 G A 10: 127,051,711 probably null Het
Cyp2d22 A G 15: 82,371,936 S404P probably damaging Het
Dclk3 G A 9: 111,468,546 S386N probably benign Het
Dnah10 G A 5: 124,777,889 D1953N possibly damaging Het
Dst T A 1: 34,264,515 probably null Het
Egfem1 A G 3: 29,657,165 N241D probably damaging Het
Entpd7 T C 19: 43,721,840 F312S probably damaging Het
Esp34 T A 17: 38,554,328 probably benign Het
Fam126b T A 1: 58,552,268 R91* probably null Het
Foxd2 T A 4: 114,907,918 T302S unknown Het
Fzd6 A T 15: 39,030,999 N187Y probably damaging Het
Gbp9 C T 5: 105,094,064 probably benign Het
Gm11492 G T 11: 87,567,418 R206L probably damaging Het
Gna14 T C 19: 16,533,769 S61P possibly damaging Het
Grap A T 11: 61,660,298 Y52F probably benign Het
H2-T3 T C 17: 36,189,428 Y125C probably damaging Het
Hecw1 A C 13: 14,316,492 S638R probably benign Het
Hira A T 16: 18,896,469 K39M probably damaging Het
Hoxa2 T A 6: 52,163,340 D222V probably damaging Het
Jph2 C T 2: 163,339,271 V658M possibly damaging Het
Kansl1 A T 11: 104,342,416 S762T probably damaging Het
Kat6b T A 14: 21,618,956 C267S probably benign Het
Klk6 A G 7: 43,831,634 N250S probably benign Het
Lbp T C 2: 158,319,714 L232S probably damaging Het
Lcn9 A T 2: 25,823,703 probably benign Het
Lcp2 A G 11: 34,075,068 H213R probably benign Het
Lrrc9 A T 12: 72,460,825 K367* probably null Het
Lyst A G 13: 13,634,482 I246V probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mst1r T C 9: 107,913,345 probably benign Het
Myo18a A G 11: 77,842,194 E909G probably benign Het
Nipbl A T 15: 8,350,289 D1006E probably benign Het
Olfr1164 A G 2: 88,093,286 F217L probably benign Het
Olfr729 C A 14: 50,148,788 V29F probably benign Het
Olfr933 A T 9: 38,975,762 I29F probably benign Het
Otog A G 7: 46,295,978 I2220V possibly damaging Het
Pcx T A 19: 4,602,024 I99N probably damaging Het
Pi4ka C T 16: 17,373,400 G211D probably benign Het
Pp2d1 T C 17: 53,507,855 S614G probably benign Het
Prdx6 G A 1: 161,244,263 A111V probably damaging Het
Prss51 G A 14: 64,096,170 probably null Het
Psmd6 C T 14: 14,116,819 probably benign Het
Pten T A 19: 32,819,850 L345Q probably damaging Het
Qrich2 T G 11: 116,441,485 H2295P probably benign Het
Rgs11 T C 17: 26,208,283 probably null Het
Rgs6 A G 12: 83,116,244 E408G probably damaging Het
Slc38a7 T C 8: 95,848,494 T53A probably benign Het
Sptbn1 A G 11: 30,113,909 C1957R probably damaging Het
Sumf1 T C 6: 108,176,058 Y123C probably damaging Het
Tnrc6b T A 15: 80,887,032 probably null Het
Ttc21a C A 9: 119,956,947 D670E probably benign Het
Ttn A G 2: 76,744,511 V25346A probably damaging Het
Ubr4 A G 4: 139,425,840 T2070A possibly damaging Het
Vmn2r57 C A 7: 41,427,830 W304L possibly damaging Het
Vps13a T C 19: 16,750,114 probably benign Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Zfp647 A G 15: 76,911,203 V419A possibly damaging Het
Other mutations in Hax1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03355:Hax1 APN 3 89997447 missense possibly damaging 0.90
R0848:Hax1 UTSW 3 89995633 missense probably damaging 1.00
R1386:Hax1 UTSW 3 89995849 missense probably damaging 1.00
R4241:Hax1 UTSW 3 89995690 missense probably damaging 0.96
R4604:Hax1 UTSW 3 89997460 missense probably damaging 0.99
R5354:Hax1 UTSW 3 89997955 missense probably damaging 0.98
R5704:Hax1 UTSW 3 89996096 missense probably damaging 1.00
R5866:Hax1 UTSW 3 89995728 unclassified probably benign
R5905:Hax1 UTSW 3 89997940 small insertion probably benign
R5913:Hax1 UTSW 3 89997940 small insertion probably benign
R5914:Hax1 UTSW 3 89997940 small insertion probably benign
R5973:Hax1 UTSW 3 89997940 small insertion probably benign
R5978:Hax1 UTSW 3 89997940 small insertion probably benign
R6026:Hax1 UTSW 3 89997940 small insertion probably benign
R6028:Hax1 UTSW 3 89997940 small insertion probably benign
R6035:Hax1 UTSW 3 89997940 small insertion probably benign
R6035:Hax1 UTSW 3 89997940 small insertion probably benign
R6054:Hax1 UTSW 3 89997940 small insertion probably benign
R6857:Hax1 UTSW 3 89997452 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCTCTGTTTAAGAACGCTATCGGG -3'
(R):5'- CACTAAGCCAGATGGGGTGAGTTG -3'

Sequencing Primer
(F):5'- GATCATCCAAAGCTGAAGATCTCTG -3'
(R):5'- TGAGTTGAGAGGAAGAAGTATAATCC -3'
Posted On2014-03-28