Incidental Mutation 'R1479:Hoxa2'
ID164195
Institutional Source Beutler Lab
Gene Symbol Hoxa2
Ensembl Gene ENSMUSG00000014704
Gene Namehomeobox A2
SynonymsHox-1.11
MMRRC Submission 039532-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1479 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location52162417-52164831 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52163340 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 222 (D222V)
Ref Sequence ENSEMBL: ENSMUSP00000014848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014848] [ENSMUST00000128102]
Predicted Effect probably damaging
Transcript: ENSMUST00000014848
AA Change: D222V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000014848
Gene: ENSMUSG00000014704
AA Change: D222V

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
HOX 139 201 2.37e-28 SMART
low complexity region 214 227 N/A INTRINSIC
low complexity region 332 367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189230
Meta Mutation Damage Score 0.04 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: This gene is located in a cluster of developmentally and temporally regulated genes on chromosome 6 encoding proteins involved in pattern formation. These proteins contain a characteristic DNA-binding motif called a homeodomain and function in transcriptional regulation. There are four distinct clusters of related genes on chromosomes 2, 6, 11, and 15. The protein encoded by this gene is expressed in rhombomere 2 and is important for hindbrain formation in the early embryo. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mutant homozygotes lack skeletal elements normally derived from the second branchial arch and show duplication of elements derived from the first branchial arch, such as ossification centers of the middle ear. Mutants die perinatally with cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,379,387 D138E probably damaging Het
1700022I11Rik A C 4: 42,972,543 K625N possibly damaging Het
2310030G06Rik T A 9: 50,741,301 T58S possibly damaging Het
4930432K21Rik C A 8: 84,162,397 T123K possibly damaging Het
Alox12e A G 11: 70,320,782 V252A probably benign Het
Anks6 T C 4: 47,044,874 D344G probably damaging Het
Atg14 A T 14: 47,547,239 probably null Het
BC052040 T A 2: 115,639,013 N74K probably benign Het
Bcr G T 10: 75,061,125 E34* probably null Het
Birc6 C T 17: 74,634,853 T2728M probably damaging Het
Bmp2k T A 5: 97,053,200 N326K probably benign Het
Ccdc188 A C 16: 18,219,290 T242P possibly damaging Het
Chsy3 A T 18: 59,408,913 E374D probably benign Het
Clca4b A T 3: 144,915,468 V615E probably damaging Het
Clcnka C A 4: 141,389,447 A498S possibly damaging Het
Csmd3 A G 15: 47,857,886 C1450R probably damaging Het
Cul7 C A 17: 46,651,747 D101E probably damaging Het
Cyp27b1 G A 10: 127,051,711 probably null Het
Cyp2d22 A G 15: 82,371,936 S404P probably damaging Het
Dclk3 G A 9: 111,468,546 S386N probably benign Het
Dnah10 G A 5: 124,777,889 D1953N possibly damaging Het
Dst T A 1: 34,264,515 probably null Het
Egfem1 A G 3: 29,657,165 N241D probably damaging Het
Entpd7 T C 19: 43,721,840 F312S probably damaging Het
Esp34 T A 17: 38,554,328 probably benign Het
Fam126b T A 1: 58,552,268 R91* probably null Het
Foxd2 T A 4: 114,907,918 T302S unknown Het
Fzd6 A T 15: 39,030,999 N187Y probably damaging Het
Gbp9 C T 5: 105,094,064 probably benign Het
Gm11492 G T 11: 87,567,418 R206L probably damaging Het
Gna14 T C 19: 16,533,769 S61P possibly damaging Het
Grap A T 11: 61,660,298 Y52F probably benign Het
H2-T3 T C 17: 36,189,428 Y125C probably damaging Het
Hax1 C A 3: 89,995,857 E212D probably damaging Het
Hecw1 A C 13: 14,316,492 S638R probably benign Het
Hira A T 16: 18,896,469 K39M probably damaging Het
Jph2 C T 2: 163,339,271 V658M possibly damaging Het
Kansl1 A T 11: 104,342,416 S762T probably damaging Het
Kat6b T A 14: 21,618,956 C267S probably benign Het
Klk6 A G 7: 43,831,634 N250S probably benign Het
Lbp T C 2: 158,319,714 L232S probably damaging Het
Lcn9 A T 2: 25,823,703 probably benign Het
Lcp2 A G 11: 34,075,068 H213R probably benign Het
Lrrc9 A T 12: 72,460,825 K367* probably null Het
Lyst A G 13: 13,634,482 I246V probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mst1r T C 9: 107,913,345 probably benign Het
Myo18a A G 11: 77,842,194 E909G probably benign Het
Nipbl A T 15: 8,350,289 D1006E probably benign Het
Olfr1164 A G 2: 88,093,286 F217L probably benign Het
Olfr729 C A 14: 50,148,788 V29F probably benign Het
Olfr933 A T 9: 38,975,762 I29F probably benign Het
Otog A G 7: 46,295,978 I2220V possibly damaging Het
Pcx T A 19: 4,602,024 I99N probably damaging Het
Pi4ka C T 16: 17,373,400 G211D probably benign Het
Pp2d1 T C 17: 53,507,855 S614G probably benign Het
Prdx6 G A 1: 161,244,263 A111V probably damaging Het
Prss51 G A 14: 64,096,170 probably null Het
Psmd6 C T 14: 14,116,819 probably benign Het
Pten T A 19: 32,819,850 L345Q probably damaging Het
Qrich2 T G 11: 116,441,485 H2295P probably benign Het
Rgs11 T C 17: 26,208,283 probably null Het
Rgs6 A G 12: 83,116,244 E408G probably damaging Het
Slc38a7 T C 8: 95,848,494 T53A probably benign Het
Sptbn1 A G 11: 30,113,909 C1957R probably damaging Het
Sumf1 T C 6: 108,176,058 Y123C probably damaging Het
Tnrc6b T A 15: 80,887,032 probably null Het
Ttc21a C A 9: 119,956,947 D670E probably benign Het
Ttn A G 2: 76,744,511 V25346A probably damaging Het
Ubr4 A G 4: 139,425,840 T2070A possibly damaging Het
Vmn2r57 C A 7: 41,427,830 W304L possibly damaging Het
Vps13a T C 19: 16,750,114 probably benign Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Zfp647 A G 15: 76,911,203 V419A possibly damaging Het
Other mutations in Hoxa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Hoxa2 APN 6 52163517 missense probably damaging 1.00
R0111:Hoxa2 UTSW 6 52164487 intron probably null
R0612:Hoxa2 UTSW 6 52163560 missense probably damaging 1.00
R1992:Hoxa2 UTSW 6 52164596 missense probably damaging 0.97
R2315:Hoxa2 UTSW 6 52162891 unclassified probably benign
R5703:Hoxa2 UTSW 6 52163263 missense probably damaging 0.98
R5994:Hoxa2 UTSW 6 52164392 missense possibly damaging 0.73
R6168:Hoxa2 UTSW 6 52163481 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACTGGGAAAGTTTGGGAGTCGCC -3'
(R):5'- GCAGCACAATAGCTGCACTGCATC -3'

Sequencing Primer
(F):5'- AGTCGCCATTGTGTCCATTG -3'
(R):5'- TCCCTGGAAATAGCTGATGGC -3'
Posted On2014-03-28