Incidental Mutation 'R1479:Klk6'
ID164198
Institutional Source Beutler Lab
Gene Symbol Klk6
Ensembl Gene ENSMUSG00000050063
Gene Namekallikrein related-peptidase 6
SynonymsBssp, Klk29, neurosin, protease M, Prss18, Prss9
MMRRC Submission 039532-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1479 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43824499-43832030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43831634 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 250 (N250S)
Ref Sequence ENSEMBL: ENSMUSP00000103602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107966] [ENSMUST00000107967] [ENSMUST00000107968] [ENSMUST00000177514]
Predicted Effect probably benign
Transcript: ENSMUST00000107966
AA Change: N250S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103600
Gene: ENSMUSG00000050063
AA Change: N250S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 28 244 3.1e-89 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107967
AA Change: N250S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103601
Gene: ENSMUSG00000050063
AA Change: N250S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 28 244 3.1e-89 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107968
AA Change: N250S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103602
Gene: ENSMUSG00000050063
AA Change: N250S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 28 244 3.1e-89 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177514
SMART Domains Protein: ENSMUSP00000135591
Gene: ENSMUSG00000050063

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 28 129 5.07e-4 SMART
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kallikrein subfamily of the peptidase S1 family of serine proteases. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. The encoded preproprotein is proteolytically processed to generate the mature protease. Expression of this protease is regulated by steroid hormones and may be elevated in multiple human cancers and in serum from psoriasis patients. The encoded protease may participate in the cleavage of amyloid precursor protein and alpha-synuclein, thus implicating this protease in Alzheimer's and Parkinson's disease, respectively. This gene is located in a gene cluster on chromosome 19. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased mature oligodendrocytes in the developing spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,379,387 D138E probably damaging Het
1700022I11Rik A C 4: 42,972,543 K625N possibly damaging Het
2310030G06Rik T A 9: 50,741,301 T58S possibly damaging Het
4930432K21Rik C A 8: 84,162,397 T123K possibly damaging Het
Alox12e A G 11: 70,320,782 V252A probably benign Het
Anks6 T C 4: 47,044,874 D344G probably damaging Het
Atg14 A T 14: 47,547,239 probably null Het
BC052040 T A 2: 115,639,013 N74K probably benign Het
Bcr G T 10: 75,061,125 E34* probably null Het
Birc6 C T 17: 74,634,853 T2728M probably damaging Het
Bmp2k T A 5: 97,053,200 N326K probably benign Het
Ccdc188 A C 16: 18,219,290 T242P possibly damaging Het
Chsy3 A T 18: 59,408,913 E374D probably benign Het
Clca4b A T 3: 144,915,468 V615E probably damaging Het
Clcnka C A 4: 141,389,447 A498S possibly damaging Het
Csmd3 A G 15: 47,857,886 C1450R probably damaging Het
Cul7 C A 17: 46,651,747 D101E probably damaging Het
Cyp27b1 G A 10: 127,051,711 probably null Het
Cyp2d22 A G 15: 82,371,936 S404P probably damaging Het
Dclk3 G A 9: 111,468,546 S386N probably benign Het
Dnah10 G A 5: 124,777,889 D1953N possibly damaging Het
Dst T A 1: 34,264,515 probably null Het
Egfem1 A G 3: 29,657,165 N241D probably damaging Het
Entpd7 T C 19: 43,721,840 F312S probably damaging Het
Esp34 T A 17: 38,554,328 probably benign Het
Fam126b T A 1: 58,552,268 R91* probably null Het
Foxd2 T A 4: 114,907,918 T302S unknown Het
Fzd6 A T 15: 39,030,999 N187Y probably damaging Het
Gbp9 C T 5: 105,094,064 probably benign Het
Gm11492 G T 11: 87,567,418 R206L probably damaging Het
Gna14 T C 19: 16,533,769 S61P possibly damaging Het
Grap A T 11: 61,660,298 Y52F probably benign Het
H2-T3 T C 17: 36,189,428 Y125C probably damaging Het
Hax1 C A 3: 89,995,857 E212D probably damaging Het
Hecw1 A C 13: 14,316,492 S638R probably benign Het
Hira A T 16: 18,896,469 K39M probably damaging Het
Hoxa2 T A 6: 52,163,340 D222V probably damaging Het
Jph2 C T 2: 163,339,271 V658M possibly damaging Het
Kansl1 A T 11: 104,342,416 S762T probably damaging Het
Kat6b T A 14: 21,618,956 C267S probably benign Het
Lbp T C 2: 158,319,714 L232S probably damaging Het
Lcn9 A T 2: 25,823,703 probably benign Het
Lcp2 A G 11: 34,075,068 H213R probably benign Het
Lrrc9 A T 12: 72,460,825 K367* probably null Het
Lyst A G 13: 13,634,482 I246V probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mst1r T C 9: 107,913,345 probably benign Het
Myo18a A G 11: 77,842,194 E909G probably benign Het
Nipbl A T 15: 8,350,289 D1006E probably benign Het
Olfr1164 A G 2: 88,093,286 F217L probably benign Het
Olfr729 C A 14: 50,148,788 V29F probably benign Het
Olfr933 A T 9: 38,975,762 I29F probably benign Het
Otog A G 7: 46,295,978 I2220V possibly damaging Het
Pcx T A 19: 4,602,024 I99N probably damaging Het
Pi4ka C T 16: 17,373,400 G211D probably benign Het
Pp2d1 T C 17: 53,507,855 S614G probably benign Het
Prdx6 G A 1: 161,244,263 A111V probably damaging Het
Prss51 G A 14: 64,096,170 probably null Het
Psmd6 C T 14: 14,116,819 probably benign Het
Pten T A 19: 32,819,850 L345Q probably damaging Het
Qrich2 T G 11: 116,441,485 H2295P probably benign Het
Rgs11 T C 17: 26,208,283 probably null Het
Rgs6 A G 12: 83,116,244 E408G probably damaging Het
Slc38a7 T C 8: 95,848,494 T53A probably benign Het
Sptbn1 A G 11: 30,113,909 C1957R probably damaging Het
Sumf1 T C 6: 108,176,058 Y123C probably damaging Het
Tnrc6b T A 15: 80,887,032 probably null Het
Ttc21a C A 9: 119,956,947 D670E probably benign Het
Ttn A G 2: 76,744,511 V25346A probably damaging Het
Ubr4 A G 4: 139,425,840 T2070A possibly damaging Het
Vmn2r57 C A 7: 41,427,830 W304L possibly damaging Het
Vps13a T C 19: 16,750,114 probably benign Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Zfp647 A G 15: 76,911,203 V419A possibly damaging Het
Other mutations in Klk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02691:Klk6 APN 7 43828500 missense probably benign 0.03
R0382:Klk6 UTSW 7 43829245 missense probably benign 0.03
R0453:Klk6 UTSW 7 43828539 missense probably damaging 1.00
R1521:Klk6 UTSW 7 43829275 critical splice donor site probably null
R1772:Klk6 UTSW 7 43829271 nonsense probably null
R1902:Klk6 UTSW 7 43826057 start codon destroyed probably benign 0.03
R4238:Klk6 UTSW 7 43829173 missense probably benign 0.02
R4239:Klk6 UTSW 7 43829173 missense probably benign 0.02
R4240:Klk6 UTSW 7 43829173 missense probably benign 0.02
R5182:Klk6 UTSW 7 43828660 missense probably benign 0.16
R5274:Klk6 UTSW 7 43829129 splice site probably null
R6776:Klk6 UTSW 7 43826874 missense probably damaging 1.00
Z1088:Klk6 UTSW 7 43828488 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCTCTTCCACACAGGGTGATTCTGG -3'
(R):5'- GCTGTTAGCCACTGAGCATTTCTCC -3'

Sequencing Primer
(F):5'- ATTCTGGAGGTCCCCTAGTATG -3'
(R):5'- cattcacactctaaagaaaagcac -3'
Posted On2014-03-28