Incidental Mutation 'R1479:Olfr933'
ID164203
Institutional Source Beutler Lab
Gene Symbol Olfr933
Ensembl Gene ENSMUSG00000058515
Gene Nameolfactory receptor 933
SynonymsGA_x6K02T2PVTD-32671531-32672457, MOR171-22
MMRRC Submission 039532-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1479 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38972313-38979861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38975762 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 29 (I29F)
Ref Sequence ENSEMBL: ENSMUSP00000149292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075680] [ENSMUST00000216238]
Predicted Effect probably benign
Transcript: ENSMUST00000075680
AA Change: I29F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075102
Gene: ENSMUSG00000058515
AA Change: I29F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-50 PFAM
Pfam:7tm_1 41 290 3.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216238
AA Change: I29F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1644 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,379,387 D138E probably damaging Het
1700022I11Rik A C 4: 42,972,543 K625N possibly damaging Het
2310030G06Rik T A 9: 50,741,301 T58S possibly damaging Het
4930432K21Rik C A 8: 84,162,397 T123K possibly damaging Het
Alox12e A G 11: 70,320,782 V252A probably benign Het
Anks6 T C 4: 47,044,874 D344G probably damaging Het
Atg14 A T 14: 47,547,239 probably null Het
BC052040 T A 2: 115,639,013 N74K probably benign Het
Bcr G T 10: 75,061,125 E34* probably null Het
Birc6 C T 17: 74,634,853 T2728M probably damaging Het
Bmp2k T A 5: 97,053,200 N326K probably benign Het
Ccdc188 A C 16: 18,219,290 T242P possibly damaging Het
Chsy3 A T 18: 59,408,913 E374D probably benign Het
Clca4b A T 3: 144,915,468 V615E probably damaging Het
Clcnka C A 4: 141,389,447 A498S possibly damaging Het
Csmd3 A G 15: 47,857,886 C1450R probably damaging Het
Cul7 C A 17: 46,651,747 D101E probably damaging Het
Cyp27b1 G A 10: 127,051,711 probably null Het
Cyp2d22 A G 15: 82,371,936 S404P probably damaging Het
Dclk3 G A 9: 111,468,546 S386N probably benign Het
Dnah10 G A 5: 124,777,889 D1953N possibly damaging Het
Dst T A 1: 34,264,515 probably null Het
Egfem1 A G 3: 29,657,165 N241D probably damaging Het
Entpd7 T C 19: 43,721,840 F312S probably damaging Het
Esp34 T A 17: 38,554,328 probably benign Het
Fam126b T A 1: 58,552,268 R91* probably null Het
Foxd2 T A 4: 114,907,918 T302S unknown Het
Fzd6 A T 15: 39,030,999 N187Y probably damaging Het
Gbp9 C T 5: 105,094,064 probably benign Het
Gm11492 G T 11: 87,567,418 R206L probably damaging Het
Gna14 T C 19: 16,533,769 S61P possibly damaging Het
Grap A T 11: 61,660,298 Y52F probably benign Het
H2-T3 T C 17: 36,189,428 Y125C probably damaging Het
Hax1 C A 3: 89,995,857 E212D probably damaging Het
Hecw1 A C 13: 14,316,492 S638R probably benign Het
Hira A T 16: 18,896,469 K39M probably damaging Het
Hoxa2 T A 6: 52,163,340 D222V probably damaging Het
Jph2 C T 2: 163,339,271 V658M possibly damaging Het
Kansl1 A T 11: 104,342,416 S762T probably damaging Het
Kat6b T A 14: 21,618,956 C267S probably benign Het
Klk6 A G 7: 43,831,634 N250S probably benign Het
Lbp T C 2: 158,319,714 L232S probably damaging Het
Lcn9 A T 2: 25,823,703 probably benign Het
Lcp2 A G 11: 34,075,068 H213R probably benign Het
Lrrc9 A T 12: 72,460,825 K367* probably null Het
Lyst A G 13: 13,634,482 I246V probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mst1r T C 9: 107,913,345 probably benign Het
Myo18a A G 11: 77,842,194 E909G probably benign Het
Nipbl A T 15: 8,350,289 D1006E probably benign Het
Olfr1164 A G 2: 88,093,286 F217L probably benign Het
Olfr729 C A 14: 50,148,788 V29F probably benign Het
Otog A G 7: 46,295,978 I2220V possibly damaging Het
Pcx T A 19: 4,602,024 I99N probably damaging Het
Pi4ka C T 16: 17,373,400 G211D probably benign Het
Pp2d1 T C 17: 53,507,855 S614G probably benign Het
Prdx6 G A 1: 161,244,263 A111V probably damaging Het
Prss51 G A 14: 64,096,170 probably null Het
Psmd6 C T 14: 14,116,819 probably benign Het
Pten T A 19: 32,819,850 L345Q probably damaging Het
Qrich2 T G 11: 116,441,485 H2295P probably benign Het
Rgs11 T C 17: 26,208,283 probably null Het
Rgs6 A G 12: 83,116,244 E408G probably damaging Het
Slc38a7 T C 8: 95,848,494 T53A probably benign Het
Sptbn1 A G 11: 30,113,909 C1957R probably damaging Het
Sumf1 T C 6: 108,176,058 Y123C probably damaging Het
Tnrc6b T A 15: 80,887,032 probably null Het
Ttc21a C A 9: 119,956,947 D670E probably benign Het
Ttn A G 2: 76,744,511 V25346A probably damaging Het
Ubr4 A G 4: 139,425,840 T2070A possibly damaging Het
Vmn2r57 C A 7: 41,427,830 W304L possibly damaging Het
Vps13a T C 19: 16,750,114 probably benign Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Zfp647 A G 15: 76,911,203 V419A possibly damaging Het
Other mutations in Olfr933
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02040:Olfr933 APN 9 38976614 unclassified probably benign
IGL03057:Olfr933 APN 9 38976218 missense probably benign 0.04
R0225:Olfr933 UTSW 9 38976278 missense probably benign 0.00
R0234:Olfr933 UTSW 9 38976251 unclassified probably null
R0234:Olfr933 UTSW 9 38976251 unclassified probably null
R1710:Olfr933 UTSW 9 38975906 missense probably damaging 0.97
R1717:Olfr933 UTSW 9 38976410 missense probably damaging 1.00
R1865:Olfr933 UTSW 9 38975904 missense probably benign 0.01
R2258:Olfr933 UTSW 9 38976000 missense probably benign 0.02
R2259:Olfr933 UTSW 9 38976000 missense probably benign 0.02
R2260:Olfr933 UTSW 9 38976000 missense probably benign 0.02
R4155:Olfr933 UTSW 9 38976155 missense probably damaging 0.99
R4299:Olfr933 UTSW 9 38975759 missense probably damaging 1.00
R4452:Olfr933 UTSW 9 38976086 missense probably benign 0.02
R5379:Olfr933 UTSW 9 38975855 missense possibly damaging 0.81
R6340:Olfr933 UTSW 9 38975766 missense probably damaging 1.00
R6497:Olfr933 UTSW 9 38976194 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTGTCAAAGCCACATCAATCCTG -3'
(R):5'- GGCCATGCACTCTGAGTAGACAATC -3'

Sequencing Primer
(F):5'- TGCTTCTACATACAGGAGAGGAATC -3'
(R):5'- TTTCTTCCCAAGAAAGTTCACCAG -3'
Posted On2014-03-28