Incidental Mutation 'R1479:Mst1r'
ID164205
Institutional Source Beutler Lab
Gene Symbol Mst1r
Ensembl Gene ENSMUSG00000032584
Gene Namemacrophage stimulating 1 receptor (c-met-related tyrosine kinase)
SynonymsFv-2, Ron, CDw136, Fv2, friend virus susceptibility 2, PTK8, STK
MMRRC Submission 039532-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R1479 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107906873-107920383 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 107913345 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035203] [ENSMUST00000195617]
Predicted Effect probably benign
Transcript: ENSMUST00000035203
SMART Domains Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 510 9.03e-116 SMART
PSI 528 570 8.72e-4 SMART
IPT 570 684 1.63e-18 SMART
IPT 685 769 4.03e-23 SMART
IPT 771 873 8.41e-12 SMART
IPT 878 972 5.36e0 SMART
TyrKc 1059 1318 8.2e-134 SMART
low complexity region 1349 1360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195113
Predicted Effect probably benign
Transcript: ENSMUST00000195617
SMART Domains Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 442 3.5e-63 SMART
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: This locus controls susceptibility to splenomegaly or spleen focus formation induced by inoculation with Friend leukemia virus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,379,387 D138E probably damaging Het
1700022I11Rik A C 4: 42,972,543 K625N possibly damaging Het
2310030G06Rik T A 9: 50,741,301 T58S possibly damaging Het
4930432K21Rik C A 8: 84,162,397 T123K possibly damaging Het
Alox12e A G 11: 70,320,782 V252A probably benign Het
Anks6 T C 4: 47,044,874 D344G probably damaging Het
Atg14 A T 14: 47,547,239 probably null Het
BC052040 T A 2: 115,639,013 N74K probably benign Het
Bcr G T 10: 75,061,125 E34* probably null Het
Birc6 C T 17: 74,634,853 T2728M probably damaging Het
Bmp2k T A 5: 97,053,200 N326K probably benign Het
Ccdc188 A C 16: 18,219,290 T242P possibly damaging Het
Chsy3 A T 18: 59,408,913 E374D probably benign Het
Clca4b A T 3: 144,915,468 V615E probably damaging Het
Clcnka C A 4: 141,389,447 A498S possibly damaging Het
Csmd3 A G 15: 47,857,886 C1450R probably damaging Het
Cul7 C A 17: 46,651,747 D101E probably damaging Het
Cyp27b1 G A 10: 127,051,711 probably null Het
Cyp2d22 A G 15: 82,371,936 S404P probably damaging Het
Dclk3 G A 9: 111,468,546 S386N probably benign Het
Dnah10 G A 5: 124,777,889 D1953N possibly damaging Het
Dst T A 1: 34,264,515 probably null Het
Egfem1 A G 3: 29,657,165 N241D probably damaging Het
Entpd7 T C 19: 43,721,840 F312S probably damaging Het
Esp34 T A 17: 38,554,328 probably benign Het
Fam126b T A 1: 58,552,268 R91* probably null Het
Foxd2 T A 4: 114,907,918 T302S unknown Het
Fzd6 A T 15: 39,030,999 N187Y probably damaging Het
Gbp9 C T 5: 105,094,064 probably benign Het
Gm11492 G T 11: 87,567,418 R206L probably damaging Het
Gna14 T C 19: 16,533,769 S61P possibly damaging Het
Grap A T 11: 61,660,298 Y52F probably benign Het
H2-T3 T C 17: 36,189,428 Y125C probably damaging Het
Hax1 C A 3: 89,995,857 E212D probably damaging Het
Hecw1 A C 13: 14,316,492 S638R probably benign Het
Hira A T 16: 18,896,469 K39M probably damaging Het
Hoxa2 T A 6: 52,163,340 D222V probably damaging Het
Jph2 C T 2: 163,339,271 V658M possibly damaging Het
Kansl1 A T 11: 104,342,416 S762T probably damaging Het
Kat6b T A 14: 21,618,956 C267S probably benign Het
Klk6 A G 7: 43,831,634 N250S probably benign Het
Lbp T C 2: 158,319,714 L232S probably damaging Het
Lcn9 A T 2: 25,823,703 probably benign Het
Lcp2 A G 11: 34,075,068 H213R probably benign Het
Lrrc9 A T 12: 72,460,825 K367* probably null Het
Lyst A G 13: 13,634,482 I246V probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Myo18a A G 11: 77,842,194 E909G probably benign Het
Nipbl A T 15: 8,350,289 D1006E probably benign Het
Olfr1164 A G 2: 88,093,286 F217L probably benign Het
Olfr729 C A 14: 50,148,788 V29F probably benign Het
Olfr933 A T 9: 38,975,762 I29F probably benign Het
Otog A G 7: 46,295,978 I2220V possibly damaging Het
Pcx T A 19: 4,602,024 I99N probably damaging Het
Pi4ka C T 16: 17,373,400 G211D probably benign Het
Pp2d1 T C 17: 53,507,855 S614G probably benign Het
Prdx6 G A 1: 161,244,263 A111V probably damaging Het
Prss51 G A 14: 64,096,170 probably null Het
Psmd6 C T 14: 14,116,819 probably benign Het
Pten T A 19: 32,819,850 L345Q probably damaging Het
Qrich2 T G 11: 116,441,485 H2295P probably benign Het
Rgs11 T C 17: 26,208,283 probably null Het
Rgs6 A G 12: 83,116,244 E408G probably damaging Het
Slc38a7 T C 8: 95,848,494 T53A probably benign Het
Sptbn1 A G 11: 30,113,909 C1957R probably damaging Het
Sumf1 T C 6: 108,176,058 Y123C probably damaging Het
Tnrc6b T A 15: 80,887,032 probably null Het
Ttc21a C A 9: 119,956,947 D670E probably benign Het
Ttn A G 2: 76,744,511 V25346A probably damaging Het
Ubr4 A G 4: 139,425,840 T2070A possibly damaging Het
Vmn2r57 C A 7: 41,427,830 W304L possibly damaging Het
Vps13a T C 19: 16,750,114 probably benign Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Zfp647 A G 15: 76,911,203 V419A possibly damaging Het
Other mutations in Mst1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Mst1r APN 9 107913250 splice site probably benign
IGL01327:Mst1r APN 9 107907844 missense probably benign 0.03
IGL01572:Mst1r APN 9 107911592 missense probably damaging 1.00
IGL01968:Mst1r APN 9 107916806 splice site probably null
IGL01983:Mst1r APN 9 107917276 missense probably damaging 0.99
IGL02096:Mst1r APN 9 107917279 missense probably damaging 0.97
IGL02203:Mst1r APN 9 107913149 missense possibly damaging 0.61
IGL02203:Mst1r APN 9 107907869 missense probably damaging 1.00
IGL02332:Mst1r APN 9 107907826 nonsense probably null
IGL02402:Mst1r APN 9 107916827 missense probably damaging 0.99
IGL02404:Mst1r APN 9 107913067 splice site probably benign
IGL02942:Mst1r APN 9 107913153 missense possibly damaging 0.89
IGL02951:Mst1r APN 9 107908204 missense possibly damaging 0.88
IGL02975:Mst1r APN 9 107913180 missense probably benign 0.20
IGL03005:Mst1r APN 9 107914549 nonsense probably null
IGL03304:Mst1r APN 9 107907938 missense probably damaging 1.00
R0386:Mst1r UTSW 9 107916804 splice site probably null
R0833:Mst1r UTSW 9 107913167 missense probably benign
R0833:Mst1r UTSW 9 107914776 missense probably benign 0.00
R1139:Mst1r UTSW 9 107919969 missense possibly damaging 0.93
R1371:Mst1r UTSW 9 107917225 missense probably damaging 1.00
R1477:Mst1r UTSW 9 107908324 missense probably benign
R1541:Mst1r UTSW 9 107917363 missense probably damaging 0.99
R1698:Mst1r UTSW 9 107919980 missense probably benign 0.06
R1891:Mst1r UTSW 9 107913462 missense probably damaging 1.00
R1971:Mst1r UTSW 9 107913212 missense probably benign 0.06
R1974:Mst1r UTSW 9 107914763 missense probably damaging 1.00
R1974:Mst1r UTSW 9 107915933 critical splice donor site probably null
R2144:Mst1r UTSW 9 107913168 missense probably benign
R2221:Mst1r UTSW 9 107908348 missense probably damaging 1.00
R2356:Mst1r UTSW 9 107917870 missense probably damaging 1.00
R3913:Mst1r UTSW 9 107914746 missense probably benign
R4768:Mst1r UTSW 9 107911650 missense probably damaging 1.00
R4793:Mst1r UTSW 9 107919925 missense probably damaging 0.96
R5141:Mst1r UTSW 9 107912241 missense probably damaging 0.99
R5191:Mst1r UTSW 9 107911551 missense probably damaging 0.98
R5238:Mst1r UTSW 9 107907574 missense probably damaging 1.00
R6024:Mst1r UTSW 9 107908151 missense probably benign 0.00
R6220:Mst1r UTSW 9 107907348 missense probably benign 0.11
R6256:Mst1r UTSW 9 107917266 missense probably damaging 1.00
R6361:Mst1r UTSW 9 107915853 missense probably benign
R6522:Mst1r UTSW 9 107913239 missense probably benign 0.00
R6559:Mst1r UTSW 9 107908271 missense possibly damaging 0.91
R6863:Mst1r UTSW 9 107920026 missense probably benign
R6868:Mst1r UTSW 9 107915933 critical splice donor site probably null
R6873:Mst1r UTSW 9 107911644 missense possibly damaging 0.90
R6978:Mst1r UTSW 9 107912594 missense probably benign 0.23
X0026:Mst1r UTSW 9 107913203 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AACTTGAATGTGAGCTGGAGCCCC -3'
(R):5'- ACCACTTGGAGTCTCCCAAAGGTAG -3'

Sequencing Primer
(F):5'- GGGACTACAAACATCAGCCTTG -3'
(R):5'- GTGGCTTCCCATAAGTTTACCTG -3'
Posted On2014-03-28