Incidental Mutation 'R1479:Wisp3'
ID164208
Institutional Source Beutler Lab
Gene Symbol Wisp3
Ensembl Gene ENSMUSG00000062074
Gene NameWNT1 inducible signaling pathway protein 3
SynonymsLOC327743, CCN6
MMRRC Submission 039532-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1479 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location39150970-39163794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 39153243 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 230 (R230W)
Ref Sequence ENSEMBL: ENSMUSP00000076003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019991] [ENSMUST00000076713] [ENSMUST00000213459]
Predicted Effect probably benign
Transcript: ENSMUST00000019991
SMART Domains Protein: ENSMUSP00000019991
Gene: ENSMUSG00000019845

DomainStartEndE-ValueType
Tubulin 55 277 1.08e-38 SMART
Tubulin_C 279 414 9.81e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076713
AA Change: R230W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076003
Gene: ENSMUSG00000062074
AA Change: R230W

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IB 46 116 1.01e-15 SMART
Blast:VWC 122 179 1e-27 BLAST
TSP1 211 253 6.58e-5 SMART
CT 273 342 1.23e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214493
Meta Mutation Damage Score 0.0732 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene is overexpressed in colon tumors. It may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Mutations of this gene are associated with progressive pseudorheumatoid dysplasia, an autosomal recessive skeletal disorder, indicating that the gene is essential for normal postnatal skeletal growth and cartilage homeostasis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with no obvious abnormalities in size, weight, skeletal development, ossification, or the occurrence of joint disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,379,387 D138E probably damaging Het
1700022I11Rik A C 4: 42,972,543 K625N possibly damaging Het
2310030G06Rik T A 9: 50,741,301 T58S possibly damaging Het
4930432K21Rik C A 8: 84,162,397 T123K possibly damaging Het
Alox12e A G 11: 70,320,782 V252A probably benign Het
Anks6 T C 4: 47,044,874 D344G probably damaging Het
Atg14 A T 14: 47,547,239 probably null Het
BC052040 T A 2: 115,639,013 N74K probably benign Het
Bcr G T 10: 75,061,125 E34* probably null Het
Birc6 C T 17: 74,634,853 T2728M probably damaging Het
Bmp2k T A 5: 97,053,200 N326K probably benign Het
Ccdc188 A C 16: 18,219,290 T242P possibly damaging Het
Chsy3 A T 18: 59,408,913 E374D probably benign Het
Clca4b A T 3: 144,915,468 V615E probably damaging Het
Clcnka C A 4: 141,389,447 A498S possibly damaging Het
Csmd3 A G 15: 47,857,886 C1450R probably damaging Het
Cul7 C A 17: 46,651,747 D101E probably damaging Het
Cyp27b1 G A 10: 127,051,711 probably null Het
Cyp2d22 A G 15: 82,371,936 S404P probably damaging Het
Dclk3 G A 9: 111,468,546 S386N probably benign Het
Dnah10 G A 5: 124,777,889 D1953N possibly damaging Het
Dst T A 1: 34,264,515 probably null Het
Egfem1 A G 3: 29,657,165 N241D probably damaging Het
Entpd7 T C 19: 43,721,840 F312S probably damaging Het
Esp34 T A 17: 38,554,328 probably benign Het
Fam126b T A 1: 58,552,268 R91* probably null Het
Foxd2 T A 4: 114,907,918 T302S unknown Het
Fzd6 A T 15: 39,030,999 N187Y probably damaging Het
Gbp9 C T 5: 105,094,064 probably benign Het
Gm11492 G T 11: 87,567,418 R206L probably damaging Het
Gna14 T C 19: 16,533,769 S61P possibly damaging Het
Grap A T 11: 61,660,298 Y52F probably benign Het
H2-T3 T C 17: 36,189,428 Y125C probably damaging Het
Hax1 C A 3: 89,995,857 E212D probably damaging Het
Hecw1 A C 13: 14,316,492 S638R probably benign Het
Hira A T 16: 18,896,469 K39M probably damaging Het
Hoxa2 T A 6: 52,163,340 D222V probably damaging Het
Jph2 C T 2: 163,339,271 V658M possibly damaging Het
Kansl1 A T 11: 104,342,416 S762T probably damaging Het
Kat6b T A 14: 21,618,956 C267S probably benign Het
Klk6 A G 7: 43,831,634 N250S probably benign Het
Lbp T C 2: 158,319,714 L232S probably damaging Het
Lcn9 A T 2: 25,823,703 probably benign Het
Lcp2 A G 11: 34,075,068 H213R probably benign Het
Lrrc9 A T 12: 72,460,825 K367* probably null Het
Lyst A G 13: 13,634,482 I246V probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mst1r T C 9: 107,913,345 probably benign Het
Myo18a A G 11: 77,842,194 E909G probably benign Het
Nipbl A T 15: 8,350,289 D1006E probably benign Het
Olfr1164 A G 2: 88,093,286 F217L probably benign Het
Olfr729 C A 14: 50,148,788 V29F probably benign Het
Olfr933 A T 9: 38,975,762 I29F probably benign Het
Otog A G 7: 46,295,978 I2220V possibly damaging Het
Pcx T A 19: 4,602,024 I99N probably damaging Het
Pi4ka C T 16: 17,373,400 G211D probably benign Het
Pp2d1 T C 17: 53,507,855 S614G probably benign Het
Prdx6 G A 1: 161,244,263 A111V probably damaging Het
Prss51 G A 14: 64,096,170 probably null Het
Psmd6 C T 14: 14,116,819 probably benign Het
Pten T A 19: 32,819,850 L345Q probably damaging Het
Qrich2 T G 11: 116,441,485 H2295P probably benign Het
Rgs11 T C 17: 26,208,283 probably null Het
Rgs6 A G 12: 83,116,244 E408G probably damaging Het
Slc38a7 T C 8: 95,848,494 T53A probably benign Het
Sptbn1 A G 11: 30,113,909 C1957R probably damaging Het
Sumf1 T C 6: 108,176,058 Y123C probably damaging Het
Tnrc6b T A 15: 80,887,032 probably null Het
Ttc21a C A 9: 119,956,947 D670E probably benign Het
Ttn A G 2: 76,744,511 V25346A probably damaging Het
Ubr4 A G 4: 139,425,840 T2070A possibly damaging Het
Vmn2r57 C A 7: 41,427,830 W304L possibly damaging Het
Vps13a T C 19: 16,750,114 probably benign Het
Zfp647 A G 15: 76,911,203 V419A possibly damaging Het
Other mutations in Wisp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Wisp3 APN 10 39158310 missense probably damaging 1.00
IGL02429:Wisp3 APN 10 39154993 missense probably benign 0.03
IGL02675:Wisp3 APN 10 39151240 missense possibly damaging 0.77
IGL03160:Wisp3 APN 10 39153237 missense probably damaging 1.00
IGL03214:Wisp3 APN 10 39153167 missense probably benign 0.04
R0666:Wisp3 UTSW 10 39151289 missense probably benign 0.45
R1350:Wisp3 UTSW 10 39158306 missense probably damaging 1.00
R1478:Wisp3 UTSW 10 39153243 missense probably damaging 1.00
R1624:Wisp3 UTSW 10 39153243 missense probably damaging 1.00
R3833:Wisp3 UTSW 10 39154949 missense probably benign 0.00
R3975:Wisp3 UTSW 10 39155098 missense probably damaging 1.00
R5051:Wisp3 UTSW 10 39155156 missense probably benign 0.00
R6000:Wisp3 UTSW 10 39158300 missense probably damaging 1.00
R6492:Wisp3 UTSW 10 39154987 missense probably benign 0.01
R6775:Wisp3 UTSW 10 39151355 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCCGCCCTCTGAGATAATTCAC -3'
(R):5'- ACAAGGCCACACTTGACTGGAAG -3'

Sequencing Primer
(F):5'- TTGATGAGATCCGAGTATAACCCC -3'
(R):5'- TCCTTTCACGTAAAAAGCCTGAG -3'
Posted On2014-03-28