Incidental Mutation 'R1479:Rgs11'
ID164241
Institutional Source Beutler Lab
Gene Symbol Rgs11
Ensembl Gene ENSMUSG00000024186
Gene Nameregulator of G-protein signaling 11
Synonyms
MMRRC Submission 039532-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R1479 (G1)
Quality Score121
Status Validated
Chromosome17
Chromosomal Location26202951-26211324 bp(+) (GRCm38)
Type of Mutationunclassified (4430 bp from exon)
DNA Base Change (assembly) T to C at 26208283 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025020] [ENSMUST00000114988] [ENSMUST00000118487] [ENSMUST00000122058]
Predicted Effect probably damaging
Transcript: ENSMUST00000025020
AA Change: I396T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025020
Gene: ENSMUSG00000024186
AA Change: I396T

DomainStartEndE-ValueType
DEP 34 109 7.78e-17 SMART
G_gamma 220 284 1.38e-19 SMART
GGL 223 284 1.1e-26 SMART
RGS 303 418 6.23e-47 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114988
SMART Domains Protein: ENSMUSP00000110639
Gene: ENSMUSG00000024187

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 218 233 N/A INTRINSIC
low complexity region 415 425 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118487
SMART Domains Protein: ENSMUSP00000113418
Gene: ENSMUSG00000024187

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 218 233 N/A INTRINSIC
low complexity region 415 425 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122058
AA Change: I394T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113885
Gene: ENSMUSG00000024186
AA Change: I394T

DomainStartEndE-ValueType
DEP 32 107 7.78e-17 SMART
G_gamma 218 282 1.38e-19 SMART
GGL 221 282 1.1e-26 SMART
RGS 301 416 6.23e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176847
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the RGS (regulator of G protein signaling) family. Members of the RGS family act as GTPase-activating proteins on the alpha subunits of heterotrimeric, signal-transducing G proteins. This protein inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound form. Alternative splicing occurs at this locus and four transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal cone and rod b-wave electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,379,387 D138E probably damaging Het
1700022I11Rik A C 4: 42,972,543 K625N possibly damaging Het
2310030G06Rik T A 9: 50,741,301 T58S possibly damaging Het
4930432K21Rik C A 8: 84,162,397 T123K possibly damaging Het
Alox12e A G 11: 70,320,782 V252A probably benign Het
Anks6 T C 4: 47,044,874 D344G probably damaging Het
Atg14 A T 14: 47,547,239 probably null Het
BC052040 T A 2: 115,639,013 N74K probably benign Het
Bcr G T 10: 75,061,125 E34* probably null Het
Birc6 C T 17: 74,634,853 T2728M probably damaging Het
Bmp2k T A 5: 97,053,200 N326K probably benign Het
Ccdc188 A C 16: 18,219,290 T242P possibly damaging Het
Chsy3 A T 18: 59,408,913 E374D probably benign Het
Clca4b A T 3: 144,915,468 V615E probably damaging Het
Clcnka C A 4: 141,389,447 A498S possibly damaging Het
Csmd3 A G 15: 47,857,886 C1450R probably damaging Het
Cul7 C A 17: 46,651,747 D101E probably damaging Het
Cyp27b1 G A 10: 127,051,711 probably null Het
Cyp2d22 A G 15: 82,371,936 S404P probably damaging Het
Dclk3 G A 9: 111,468,546 S386N probably benign Het
Dnah10 G A 5: 124,777,889 D1953N possibly damaging Het
Dst T A 1: 34,264,515 probably null Het
Egfem1 A G 3: 29,657,165 N241D probably damaging Het
Entpd7 T C 19: 43,721,840 F312S probably damaging Het
Esp34 T A 17: 38,554,328 probably benign Het
Fam126b T A 1: 58,552,268 R91* probably null Het
Foxd2 T A 4: 114,907,918 T302S unknown Het
Fzd6 A T 15: 39,030,999 N187Y probably damaging Het
Gbp9 C T 5: 105,094,064 probably benign Het
Gm11492 G T 11: 87,567,418 R206L probably damaging Het
Gna14 T C 19: 16,533,769 S61P possibly damaging Het
Grap A T 11: 61,660,298 Y52F probably benign Het
H2-T3 T C 17: 36,189,428 Y125C probably damaging Het
Hax1 C A 3: 89,995,857 E212D probably damaging Het
Hecw1 A C 13: 14,316,492 S638R probably benign Het
Hira A T 16: 18,896,469 K39M probably damaging Het
Hoxa2 T A 6: 52,163,340 D222V probably damaging Het
Jph2 C T 2: 163,339,271 V658M possibly damaging Het
Kansl1 A T 11: 104,342,416 S762T probably damaging Het
Kat6b T A 14: 21,618,956 C267S probably benign Het
Klk6 A G 7: 43,831,634 N250S probably benign Het
Lbp T C 2: 158,319,714 L232S probably damaging Het
Lcn9 A T 2: 25,823,703 probably benign Het
Lcp2 A G 11: 34,075,068 H213R probably benign Het
Lrrc9 A T 12: 72,460,825 K367* probably null Het
Lyst A G 13: 13,634,482 I246V probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mst1r T C 9: 107,913,345 probably benign Het
Myo18a A G 11: 77,842,194 E909G probably benign Het
Nipbl A T 15: 8,350,289 D1006E probably benign Het
Olfr1164 A G 2: 88,093,286 F217L probably benign Het
Olfr729 C A 14: 50,148,788 V29F probably benign Het
Olfr933 A T 9: 38,975,762 I29F probably benign Het
Otog A G 7: 46,295,978 I2220V possibly damaging Het
Pcx T A 19: 4,602,024 I99N probably damaging Het
Pi4ka C T 16: 17,373,400 G211D probably benign Het
Pp2d1 T C 17: 53,507,855 S614G probably benign Het
Prdx6 G A 1: 161,244,263 A111V probably damaging Het
Prss51 G A 14: 64,096,170 probably null Het
Psmd6 C T 14: 14,116,819 probably benign Het
Pten T A 19: 32,819,850 L345Q probably damaging Het
Qrich2 T G 11: 116,441,485 H2295P probably benign Het
Rgs6 A G 12: 83,116,244 E408G probably damaging Het
Slc38a7 T C 8: 95,848,494 T53A probably benign Het
Sptbn1 A G 11: 30,113,909 C1957R probably damaging Het
Sumf1 T C 6: 108,176,058 Y123C probably damaging Het
Tnrc6b T A 15: 80,887,032 probably null Het
Ttc21a C A 9: 119,956,947 D670E probably benign Het
Ttn A G 2: 76,744,511 V25346A probably damaging Het
Ubr4 A G 4: 139,425,840 T2070A possibly damaging Het
Vmn2r57 C A 7: 41,427,830 W304L possibly damaging Het
Vps13a T C 19: 16,750,114 probably benign Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Zfp647 A G 15: 76,911,203 V419A possibly damaging Het
Other mutations in Rgs11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Rgs11 APN 17 26207397 missense probably damaging 1.00
IGL01617:Rgs11 APN 17 26208250 missense probably damaging 1.00
IGL02150:Rgs11 APN 17 26202994 missense probably benign 0.05
IGL02610:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02612:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02617:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02669:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02670:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02674:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02706:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02707:Rgs11 APN 17 26207631 missense probably benign 0.31
IGL02741:Rgs11 APN 17 26207631 missense probably benign 0.31
R0147:Rgs11 UTSW 17 26207459 critical splice donor site probably null
R0148:Rgs11 UTSW 17 26207459 critical splice donor site probably null
R0508:Rgs11 UTSW 17 26207469 splice site probably benign
R0744:Rgs11 UTSW 17 26203318 missense probably damaging 1.00
R1599:Rgs11 UTSW 17 26208249 missense probably damaging 1.00
R1779:Rgs11 UTSW 17 26210666 missense probably damaging 1.00
R3692:Rgs11 UTSW 17 26204328 unclassified probably benign
R3807:Rgs11 UTSW 17 26203500 missense probably damaging 0.99
R3889:Rgs11 UTSW 17 26207587 missense probably damaging 0.98
R4689:Rgs11 UTSW 17 26204547 critical splice donor site probably null
R4832:Rgs11 UTSW 17 26207568 missense probably benign 0.00
R5052:Rgs11 UTSW 17 26207973 intron probably benign
R5330:Rgs11 UTSW 17 26202973 start codon destroyed probably benign 0.01
R5331:Rgs11 UTSW 17 26202973 start codon destroyed probably benign 0.01
R5683:Rgs11 UTSW 17 26205181 missense probably benign 0.32
R5879:Rgs11 UTSW 17 26203463 unclassified probably benign
R6156:Rgs11 UTSW 17 26210465 nonsense probably null
R6671:Rgs11 UTSW 17 26208298 missense probably damaging 1.00
Z1088:Rgs11 UTSW 17 26205772 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTCCTTAGCGGAAAACCTCAGC -3'
(R):5'- ACAGAGGCAATACCCACTCCTGATG -3'

Sequencing Primer
(F):5'- CCACCTTGGTGGACTCTGTG -3'
(R):5'- TCCTGATGGAGCCAAACG -3'
Posted On2014-03-28