Incidental Mutation 'R1480:Kit'
ID164276
Institutional Source Beutler Lab
Gene Symbol Kit
Ensembl Gene ENSMUSG00000005672
Gene NameKIT proto-oncogene receptor tyrosine kinase
SynonymsSCO5, Dominant white spotting, Tr-kit, belly-spot, CD117, Gsfsow3, Gsfsco5, SOW3, SCO1, Steel Factor Receptor, c-KIT, Gsfsco1
MMRRC Submission 039533-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.858) question?
Stock #R1480 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location75574916-75656722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75637317 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 422 (D422N)
Ref Sequence ENSEMBL: ENSMUSP00000116465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005815] [ENSMUST00000144270]
Predicted Effect probably benign
Transcript: ENSMUST00000005815
AA Change: D422N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000005815
Gene: ENSMUSG00000005672
AA Change: D422N

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
IG 43 113 3.02e0 SMART
IG_like 122 206 1.09e2 SMART
IGc2 225 300 3.79e-4 SMART
IG 323 413 1.21e-2 SMART
IG_like 429 501 1.88e0 SMART
transmembrane domain 524 546 N/A INTRINSIC
TyrKc 592 926 2.5e-138 SMART
low complexity region 945 963 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136002
Predicted Effect probably benign
Transcript: ENSMUST00000144270
AA Change: D422N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000116465
Gene: ENSMUSG00000005672
AA Change: D422N

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 22 30 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
IG 55 125 3.02e0 SMART
IG_like 134 218 1.09e2 SMART
IGc2 237 312 3.79e-4 SMART
IG 335 425 1.21e-2 SMART
IG_like 441 513 1.88e0 SMART
transmembrane domain 532 554 N/A INTRINSIC
TyrKc 600 934 2.5e-138 SMART
low complexity region 953 971 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151357
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 C T 2: 25,433,397 R126C possibly damaging Het
Abcb9 C A 5: 124,078,826 A443S probably benign Het
Adcy3 A G 12: 4,212,171 M1075V probably damaging Het
Adnp A G 2: 168,183,534 Y614H probably damaging Het
Agbl4 G A 4: 111,566,717 M313I possibly damaging Het
AI987944 T C 7: 41,374,919 D212G probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Aplp1 A G 7: 30,436,023 S537P probably benign Het
Arap2 T A 5: 62,669,129 R1031* probably null Het
Arid1a A G 4: 133,680,389 M2269T unknown Het
Ash1l C A 3: 88,985,052 P1413T probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
B3gnt5 A T 16: 19,769,867 I279L probably damaging Het
Camkk2 T C 5: 122,734,278 probably null Het
Ccdc158 T C 5: 92,649,044 K478E probably damaging Het
Ces1f T C 8: 93,274,154 I121V probably benign Het
Chad A T 11: 94,565,137 I14F probably benign Het
Col6a1 T C 10: 76,709,918 I907V unknown Het
Cpe T A 8: 64,594,935 T432S probably benign Het
Csmd3 T C 15: 47,731,929 T1941A possibly damaging Het
Dennd3 G A 15: 73,532,846 V257I probably benign Het
Dnajc21 T C 15: 10,459,951 N148S probably null Het
Dqx1 A G 6: 83,059,452 R146G possibly damaging Het
Etf1 T C 18: 34,909,223 E261G probably damaging Het
Fermt2 C T 14: 45,461,787 V617I possibly damaging Het
Gabarap T C 11: 69,991,725 Y5H probably damaging Het
Gdap1 A G 1: 17,145,557 Y29C probably damaging Het
Gimap5 A G 6: 48,753,030 E178G probably damaging Het
Gpatch1 C T 7: 35,303,338 G249E probably damaging Het
Gse1 T G 8: 120,572,394 L794R probably benign Het
Kifc3 T C 8: 95,109,887 D82G probably damaging Het
Klhl28 A T 12: 64,957,221 F173I probably damaging Het
Klk1b22 A G 7: 44,116,854 D253G possibly damaging Het
Lias T A 5: 65,392,291 H39Q probably benign Het
Lrp1b T A 2: 40,903,389 D2504V probably damaging Het
Mgat5 A T 1: 127,459,979 R557S probably damaging Het
Mrpl54 T C 10: 81,265,655 T91A probably benign Het
Myh3 T A 11: 67,093,545 D1069E possibly damaging Het
Nek1 T A 8: 61,124,326 probably null Het
Nfyc A C 4: 120,768,724 probably null Het
Nol7 A T 13: 43,398,628 E75V probably damaging Het
Nomo1 T A 7: 46,060,913 V606E probably damaging Het
Npat TGGTAAAA T 9: 53,563,066 probably null Het
Nt5c1b A G 12: 10,374,886 E142G probably damaging Het
Ogdh A T 11: 6,347,827 probably null Het
Olfr99 A G 17: 37,279,745 V225A probably benign Het
Parg A T 14: 32,209,628 K402* probably null Het
Patj G A 4: 98,469,582 G699E probably damaging Het
Pde3a G A 6: 141,487,574 S777N probably benign Het
Phactr2 G A 10: 13,253,792 P174L possibly damaging Het
Phtf1 C T 3: 103,987,434 R166* probably null Het
Pik3r4 G T 9: 105,687,244 V1346L probably benign Het
Prkcb T C 7: 122,594,642 W525R probably damaging Het
Prl8a1 C T 13: 27,574,072 R218H possibly damaging Het
Pum3 T C 19: 27,398,910 E536G probably benign Het
Rb1 T C 14: 73,262,602 N535S probably benign Het
Rbm7 G T 9: 48,489,716 D237E probably benign Het
Ripor1 T C 8: 105,615,548 V122A probably damaging Het
Sdhc C T 1: 171,145,801 R11H probably benign Het
Sema3c A G 5: 17,682,031 N360S possibly damaging Het
Serpinb5 T A 1: 106,881,707 M281K probably benign Het
Serpinc1 A G 1: 160,995,319 E210G probably benign Het
Shoc2 T C 19: 53,987,771 S31P probably benign Het
Sult2a3 T A 7: 14,122,911 N28I possibly damaging Het
Svil C T 18: 5,057,345 P598S probably damaging Het
Tacc3 G A 5: 33,664,597 V234I probably benign Het
Tacr1 A T 6: 82,492,530 M132L possibly damaging Het
Tas2r104 C A 6: 131,685,294 V151F probably benign Het
Tbc1d10b C T 7: 127,203,778 S326N probably benign Het
Trim12c C T 7: 104,348,244 C35Y probably damaging Het
Trrap T C 5: 144,818,313 I2067T probably benign Het
Upk1a T C 7: 30,606,886 I152V probably benign Het
Vmn2r39 T G 7: 9,014,956 T794P probably damaging Het
Wnk2 G A 13: 49,057,232 P1704S probably damaging Het
Zfp609 T C 9: 65,703,311 E790G possibly damaging Het
Zmym1 G T 4: 127,048,612 T563K probably damaging Het
Zranb1 T A 7: 132,950,016 F132Y probably benign Het
Zranb3 C T 1: 128,091,862 A48T probably damaging Het
Other mutations in Kit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kit APN 5 75610819 missense probably benign 0.00
IGL00834:Kit APN 5 75645959 missense probably damaging 1.00
IGL00846:Kit APN 5 75640811 missense probably damaging 0.98
IGL01149:Kit APN 5 75610876 missense probably damaging 0.97
IGL01341:Kit APN 5 75607074 missense probably damaging 1.00
IGL02004:Kit APN 5 75621014 missense probably benign
IGL02281:Kit APN 5 75654534 missense possibly damaging 0.66
IGL02424:Kit APN 5 75639106 missense probably benign
IGL02697:Kit APN 5 75607259 missense probably benign
IGL02929:Kit APN 5 75640769 missense probably damaging 1.00
IGL03053:Kit APN 5 75610914 missense probably benign
IGL03127:Kit APN 5 75641188 missense probably benign 0.44
IGL03174:Kit APN 5 75607113 missense probably benign
IGL03381:Kit APN 5 75607128 missense probably benign 0.04
Casper UTSW 5 75645875 missense probably damaging 1.00
pretty2 UTSW 5 75649550 missense probably damaging 1.00
IGL02837:Kit UTSW 5 75639008 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0092:Kit UTSW 5 75647754 missense possibly damaging 0.93
R0254:Kit UTSW 5 75620921 missense probably benign
R0329:Kit UTSW 5 75652829 missense probably damaging 1.00
R0609:Kit UTSW 5 75610879 missense probably benign 0.35
R1068:Kit UTSW 5 75609518 missense probably benign
R1115:Kit UTSW 5 75649532 splice site probably benign
R1639:Kit UTSW 5 75652807 missense probably damaging 1.00
R1801:Kit UTSW 5 75648393 missense probably damaging 1.00
R1973:Kit UTSW 5 75615442 missense probably damaging 1.00
R2033:Kit UTSW 5 75637317 missense possibly damaging 0.88
R3125:Kit UTSW 5 75647827 missense probably benign 0.07
R3125:Kit UTSW 5 75647828 missense probably null 0.00
R3437:Kit UTSW 5 75645905 missense probably damaging 1.00
R3791:Kit UTSW 5 75639150 missense probably damaging 1.00
R3939:Kit UTSW 5 75609318 missense probably benign 0.00
R3940:Kit UTSW 5 75609318 missense probably benign 0.00
R3941:Kit UTSW 5 75609318 missense probably benign 0.00
R3942:Kit UTSW 5 75609318 missense probably benign 0.00
R4092:Kit UTSW 5 75610810 missense probably benign 0.28
R4376:Kit UTSW 5 75640499 missense probably benign 0.00
R4377:Kit UTSW 5 75640499 missense probably benign 0.00
R4668:Kit UTSW 5 75641220 splice site probably null
R5104:Kit UTSW 5 75615478 missense probably benign 0.00
R5152:Kit UTSW 5 75620847 missense probably benign 0.00
R5154:Kit UTSW 5 75640540 missense probably damaging 0.99
R5508:Kit UTSW 5 75649548 missense probably damaging 1.00
R5624:Kit UTSW 5 75609394 missense probably benign 0.40
R5731:Kit UTSW 5 75654415 missense possibly damaging 0.93
R6270:Kit UTSW 5 75609509 missense probably benign
R6565:Kit UTSW 5 75645853 missense probably damaging 1.00
R6694:Kit UTSW 5 75640757 missense possibly damaging 0.94
R6805:Kit UTSW 5 75652808 missense probably damaging 1.00
R6823:Kit UTSW 5 75652649 missense probably benign 0.01
R6848:Kit UTSW 5 75607212 missense probably benign
U24488:Kit UTSW 5 75623014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCCTGATACCTTCAGGCCGATGG -3'
(R):5'- CCCACTGCTCACAAACGCTGTATG -3'

Sequencing Primer
(F):5'- GCTGGACAACATACCCACTG -3'
(R):5'- GGGAAATTGCTTTATCTACCTGC -3'
Posted OnMar 28, 2014