Incidental Mutation 'R1480:Olfr99'
ID164338
Institutional Source Beutler Lab
Gene Symbol Olfr99
Ensembl Gene ENSMUSG00000061972
Gene Nameolfactory receptor 99
SynonymsMOR156-1, GA_x6K02T2PSCP-1720261-1719344
MMRRC Submission 039533-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1480 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37279043-37283460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37279745 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 225 (V225A)
Ref Sequence ENSEMBL: ENSMUSP00000148900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077585] [ENSMUST00000216328]
Predicted Effect probably benign
Transcript: ENSMUST00000077585
AA Change: V225A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000076781
Gene: ENSMUSG00000061972
AA Change: V225A

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.8e-58 PFAM
Pfam:7TM_GPCR_Srsx 32 302 1.4e-6 PFAM
Pfam:7tm_1 38 287 1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173568
Predicted Effect probably benign
Transcript: ENSMUST00000216328
AA Change: V225A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216370
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 C T 2: 25,433,397 R126C possibly damaging Het
Abcb9 C A 5: 124,078,826 A443S probably benign Het
Adcy3 A G 12: 4,212,171 M1074V probably damaging Het
Adnp A G 2: 168,183,534 Y614H probably damaging Het
Agbl4 G A 4: 111,566,717 M313I possibly damaging Het
AI987944 T C 7: 41,374,919 D212G probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Aplp1 A G 7: 30,436,023 S537P probably benign Het
Arap2 T A 5: 62,669,129 R1031* probably null Het
Arid1a A G 4: 133,680,389 M2269T unknown Het
Ash1l C A 3: 88,985,052 P1413T probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
B3gnt5 A T 16: 19,769,867 I279L probably damaging Het
Camkk2 T C 5: 122,734,278 probably null Het
Ccdc158 T C 5: 92,649,044 K478E probably damaging Het
Ces1f T C 8: 93,274,154 I121V probably benign Het
Chad A T 11: 94,565,137 probably benign Het
Col6a1 T C 10: 76,709,918 I907V unknown Het
Cpe T A 8: 64,594,935 T432S probably benign Het
Csmd3 T C 15: 47,731,929 T1941A possibly damaging Het
Dennd3 G A 15: 73,532,846 V257I probably benign Het
Dnajc21 T C 15: 10,459,951 probably null Het
Dqx1 A G 6: 83,059,452 R146G possibly damaging Het
Etf1 T C 18: 34,909,223 E261G probably damaging Het
Fermt2 C T 14: 45,461,787 V617I possibly damaging Het
Gabarap T C 11: 69,991,725 Y5H probably damaging Het
Gdap1 A G 1: 17,145,557 Y29C probably damaging Het
Gimap5 A G 6: 48,753,030 E178G probably damaging Het
Gpatch1 C T 7: 35,303,338 G249E probably damaging Het
Gse1 T G 8: 120,572,394 probably benign Het
Kifc3 T C 8: 95,109,887 D82G probably damaging Het
Kit G A 5: 75,637,317 D422N probably benign Het
Klhl28 A T 12: 64,957,221 F173I probably damaging Het
Klk1b22 A G 7: 44,116,854 D253G possibly damaging Het
Lias T A 5: 65,392,291 H39Q probably benign Het
Lrp1b T A 2: 40,903,389 D2504V probably damaging Het
Mgat5 A T 1: 127,459,979 R557S probably damaging Het
Mrpl54 T C 10: 81,265,655 T91A probably benign Het
Myh3 T A 11: 67,093,545 D1069E possibly damaging Het
Nek1 T A 8: 61,124,326 probably null Het
Nfyc A C 4: 120,768,724 probably null Het
Nol7 A T 13: 43,398,628 E75V probably damaging Het
Nomo1 T A 7: 46,060,913 V606E probably damaging Het
Npat TGGTAAAA T 9: 53,563,066 probably null Het
Nt5c1b A G 12: 10,374,886 E142G probably damaging Het
Ogdh A T 11: 6,347,827 probably null Het
Parg A T 14: 32,209,628 K402* probably null Het
Patj G A 4: 98,469,582 G695E probably damaging Het
Pde3a G A 6: 141,487,574 S777N probably benign Het
Phactr2 G A 10: 13,253,792 P174L possibly damaging Het
Phtf1 C T 3: 103,987,434 R113* probably null Het
Pik3r4 G T 9: 105,687,244 V1346L probably benign Het
Prkcb T C 7: 122,594,642 W525R probably damaging Het
Prl8a1 C T 13: 27,574,072 R218H possibly damaging Het
Pum3 T C 19: 27,398,910 E536G probably benign Het
Rb1 T C 14: 73,262,602 N535S probably benign Het
Rbm7 G T 9: 48,489,716 D237E probably benign Het
Ripor1 T C 8: 105,615,548 V122A probably damaging Het
Sdhc C T 1: 171,145,801 R11H probably benign Het
Sema3c A G 5: 17,682,031 N360S possibly damaging Het
Serpinb5 T A 1: 106,881,707 M281K probably benign Het
Serpinc1 A G 1: 160,995,319 E210G probably benign Het
Shoc2 T C 19: 53,987,771 S31P probably benign Het
Sult2a3 T A 7: 14,122,911 N28I possibly damaging Het
Svil C T 18: 5,057,345 P598S probably damaging Het
Tacc3 G A 5: 33,664,597 V234I probably benign Het
Tacr1 A T 6: 82,492,530 M132L possibly damaging Het
Tas2r104 C A 6: 131,685,294 V151F probably benign Het
Tbc1d10b C T 7: 127,203,778 S326N probably benign Het
Trim12c C T 7: 104,348,244 C35Y probably damaging Het
Trrap T C 5: 144,818,313 I2067T probably benign Het
Upk1a T C 7: 30,606,886 I152V probably benign Het
Vmn2r39 T G 7: 9,014,956 T794P probably damaging Het
Wnk2 G A 13: 49,057,232 P1704S probably damaging Het
Zfp609 T C 9: 65,703,311 E790G possibly damaging Het
Zmym1 G T 4: 127,048,612 T563K probably damaging Het
Zranb1 T A 7: 132,950,016 F132Y probably benign Het
Zranb3 C T 1: 128,091,862 A48T probably damaging Het
Other mutations in Olfr99
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01878:Olfr99 APN 17 37280000 missense possibly damaging 0.46
IGL02954:Olfr99 APN 17 37280304 missense probably damaging 1.00
R0533:Olfr99 UTSW 17 37280291 nonsense probably null
R2872:Olfr99 UTSW 17 37279976 missense possibly damaging 0.64
R2872:Olfr99 UTSW 17 37279976 missense possibly damaging 0.64
R3772:Olfr99 UTSW 17 37279854 missense probably benign 0.00
R3826:Olfr99 UTSW 17 37280249 missense probably damaging 1.00
R3827:Olfr99 UTSW 17 37280249 missense probably damaging 1.00
R3829:Olfr99 UTSW 17 37280249 missense probably damaging 1.00
R5210:Olfr99 UTSW 17 37279933 missense probably benign 0.13
R5361:Olfr99 UTSW 17 37279610 missense probably benign 0.02
R6213:Olfr99 UTSW 17 37280373 missense probably benign
R6399:Olfr99 UTSW 17 37279775 missense probably damaging 1.00
R6881:Olfr99 UTSW 17 37280309 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCCACGGTGTTAACTGACTCAC -3'
(R):5'- ACTGCGCTACTCAGCTCTCATGAC -3'

Sequencing Primer
(F):5'- ACTGAGACTACTCCATGTTTAGG -3'
(R):5'- GAGTAACTAATTGTGTGTCTCTGACC -3'
Posted On2014-03-28