Incidental Mutation 'R1481:Cd300ld2'
ID164392
Institutional Source Beutler Lab
Gene Symbol Cd300ld2
Ensembl Gene ENSMUSG00000089753
Gene NameCD300 molecule like family member D2
SynonymsGm11709
MMRRC Submission 039534-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R1481 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115010335-115016193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115012633 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 129 (I129F)
Ref Sequence ENSEMBL: ENSMUSP00000102188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092463] [ENSMUST00000106578]
Predicted Effect probably benign
Transcript: ENSMUST00000092463
SMART Domains Protein: ENSMUSP00000090120
Gene: ENSMUSG00000089753

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 124 2.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106578
AA Change: I129F

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102188
Gene: ENSMUSG00000089753
AA Change: I129F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 124 2.11e-2 SMART
low complexity region 131 201 N/A INTRINSIC
low complexity region 202 222 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
Meta Mutation Damage Score 0.1044 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 37,008,434 V3365A probably damaging Het
Arhgef5 A G 6: 43,274,634 H773R probably damaging Het
Bmp3 G A 5: 98,872,470 V251M probably damaging Het
Ccdc175 C A 12: 72,101,948 probably benign Het
Ccdc178 C T 18: 22,105,621 G313D probably benign Het
Cep170 T C 1: 176,782,385 Q120R possibly damaging Het
Ckb T C 12: 111,671,262 H145R probably benign Het
Cntnap5a T A 1: 116,117,663 N336K probably damaging Het
Coil T A 11: 88,974,060 C38S possibly damaging Het
Cps1 T C 1: 67,143,882 V133A probably damaging Het
Cspg4 A G 9: 56,887,810 E943G probably damaging Het
Cyp2c54 C T 19: 40,047,588 D293N probably benign Het
Cyp2f2 T C 7: 27,121,877 S72P probably benign Het
Dip2c G A 13: 9,551,866 probably null Het
Dock6 T C 9: 21,820,622 T1158A probably benign Het
Dscaml1 G A 9: 45,672,643 V469I probably benign Het
Efcab14 A G 4: 115,756,517 T221A probably benign Het
Ehbp1 T C 11: 22,006,782 *1207W probably null Het
Eln T C 5: 134,706,572 K786E probably damaging Het
Fyb C T 15: 6,619,647 P385S probably benign Het
Galr1 A G 18: 82,405,741 I137T possibly damaging Het
Gcm1 A T 9: 78,059,717 K73* probably null Het
Gemin5 T C 11: 58,141,654 N775D probably damaging Het
Gli3 C T 13: 15,613,850 H147Y probably damaging Het
Gm10754 G T 10: 97,682,227 probably benign Het
Gpr37 T C 6: 25,669,138 D569G probably damaging Het
Grina T A 15: 76,249,089 Y286N probably damaging Het
Gtf3c1 C A 7: 125,693,138 probably null Het
Kcnc4 C T 3: 107,448,218 V305M probably benign Het
Kntc1 T C 5: 123,778,275 F724L probably benign Het
Kpnb1 T C 11: 97,178,310 Y249C probably damaging Het
Krt6b T C 15: 101,678,374 T269A probably benign Het
Lamc1 T C 1: 153,221,634 K1555E probably damaging Het
Maneal T C 4: 124,861,857 Y104C probably damaging Het
Map1b T C 13: 99,431,171 T1681A unknown Het
Mettl17 T C 14: 51,890,703 L272P probably benign Het
Mib2 T A 4: 155,656,999 S357C probably benign Het
Mmp19 C A 10: 128,798,178 T316K possibly damaging Het
Mroh9 C T 1: 163,026,509 G774E probably damaging Het
Myh1 T C 11: 67,205,499 probably benign Het
Ncor2 C A 5: 125,027,138 E963* probably null Het
Nol6 T A 4: 41,123,596 T51S probably benign Het
Nsun3 A T 16: 62,735,369 C265S probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Nutm2 T A 13: 50,469,481 N71K probably damaging Het
Olfr498 C T 7: 108,465,960 T212I probably benign Het
Olfr713 T G 7: 107,036,149 L5R probably benign Het
Orc3 T A 4: 34,607,228 E34V possibly damaging Het
Pcdhb13 T A 18: 37,442,836 L89Q probably damaging Het
Polr3a A T 14: 24,452,548 V1241E probably null Het
Prpf39 C T 12: 65,053,314 P135S probably damaging Het
Psrc1 T C 3: 108,384,993 V34A probably benign Het
Rab27a G A 9: 73,082,402 V52M probably benign Het
Rassf9 A G 10: 102,546,034 T424A probably benign Het
Ripor3 G T 2: 168,000,377 R61S possibly damaging Het
Ryr3 C T 2: 112,636,522 probably benign Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Setbp1 C T 18: 78,783,301 V1366M probably benign Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Tctn2 T C 5: 124,607,763 noncoding transcript Het
Tmem45a A T 16: 56,811,602 F218I possibly damaging Het
Tpte A T 8: 22,355,471 R512S probably damaging Het
Trim37 T A 11: 87,129,759 L22* probably null Het
Ttc6 A G 12: 57,737,130 N1792D probably damaging Het
Ttn A G 2: 76,945,616 M1694T probably damaging Het
Vmn1r181 T A 7: 23,984,712 W201R probably damaging Het
Wdr74 C T 19: 8,738,228 L198F possibly damaging Het
Zfp560 T C 9: 20,348,790 T259A probably benign Het
Other mutations in Cd300ld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Cd300ld2 APN 11 115012297 missense probably benign 0.23
IGL01450:Cd300ld2 APN 11 115012543 unclassified probably benign
IGL01452:Cd300ld2 APN 11 115012602 unclassified probably benign
IGL02086:Cd300ld2 APN 11 115012558 unclassified probably benign
IGL02111:Cd300ld2 APN 11 115012393 unclassified probably benign
IGL02505:Cd300ld2 APN 11 115013687 missense probably benign 0.11
IGL02517:Cd300ld2 APN 11 115010423 missense possibly damaging 0.53
IGL02836:Cd300ld2 APN 11 115013750 missense probably benign 0.07
IGL03081:Cd300ld2 APN 11 115012542 unclassified probably benign
PIT4486001:Cd300ld2 UTSW 11 115012431 small deletion probably benign
R0579:Cd300ld2 UTSW 11 115012299 missense probably benign 0.23
R1065:Cd300ld2 UTSW 11 115013760 missense probably damaging 1.00
R1393:Cd300ld2 UTSW 11 115012578 unclassified probably benign
R1583:Cd300ld2 UTSW 11 115013777 missense probably benign 0.06
R1755:Cd300ld2 UTSW 11 115013775 missense probably benign 0.01
R1865:Cd300ld2 UTSW 11 115012618 unclassified probably benign
R4018:Cd300ld2 UTSW 11 115012504 unclassified probably benign
R5516:Cd300ld2 UTSW 11 115012444 unclassified probably benign
R6065:Cd300ld2 UTSW 11 115012602 unclassified probably benign
R6927:Cd300ld2 UTSW 11 115013793 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAATGTTCTCTGTGCCAATGC -3'
(R):5'- AATGAGACAGCACACTCTGAAGGAATC -3'

Sequencing Primer
(F):5'- GATGGCAGAACTGTGGATGG -3'
(R):5'- gcacacctttaataccagcac -3'
Posted On2014-03-28