Incidental Mutation 'R1482:Bcl2l14'
ID164441
Institutional Source Beutler Lab
Gene Symbol Bcl2l14
Ensembl Gene ENSMUSG00000030200
Gene NameBCL2-like 14 (apoptosis facilitator)
Synonyms
MMRRC Submission 039535-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.044) question?
Stock #R1482 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location134396318-134438736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134427302 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 151 (D151G)
Ref Sequence ENSEMBL: ENSMUSP00000132525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032321] [ENSMUST00000111960] [ENSMUST00000127865] [ENSMUST00000163589]
Predicted Effect probably damaging
Transcript: ENSMUST00000032321
AA Change: D151G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032321
Gene: ENSMUSG00000030200
AA Change: D151G

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
SCOP:d1maz__ 200 320 5e-23 SMART
Blast:BCL 217 316 4e-43 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111960
AA Change: D151G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107591
Gene: ENSMUSG00000030200
AA Change: D151G

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
SCOP:d1maz__ 200 320 5e-23 SMART
Blast:BCL 217 316 4e-43 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127865
SMART Domains Protein: ENSMUSP00000115608
Gene: ENSMUSG00000030200

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142612
Predicted Effect probably damaging
Transcript: ENSMUST00000163589
AA Change: D151G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132525
Gene: ENSMUSG00000030200
AA Change: D151G

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
SCOP:d1maz__ 200 320 5e-23 SMART
Blast:BCL 217 316 4e-43 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205104
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 83.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. Overexpression of this gene has been shown to induce apoptosis in cells. Three alternatively spliced transcript variants encoding two distinct isoforms have been reported for this gene. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik G A 19: 3,717,192 D260N probably benign Het
AI314180 T C 4: 58,820,163 K1217E possibly damaging Het
Ankef1 A T 2: 136,550,158 K422N possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Aqp6 A T 15: 99,604,307 *294C probably null Het
Baz2a T A 10: 128,109,008 M38K possibly damaging Het
Cabp5 T A 7: 13,398,342 L12* probably null Het
Cachd1 T C 4: 100,988,598 V993A possibly damaging Het
Cd44 G A 2: 102,831,383 T306I probably damaging Het
Cdc20 A T 4: 118,437,056 N22K probably benign Het
Cdc6 T A 11: 98,916,981 D433E possibly damaging Het
Clhc1 A G 11: 29,553,725 D47G probably damaging Het
Csf2 T C 11: 54,248,563 K65E probably benign Het
Cul9 T C 17: 46,508,547 E2005G probably damaging Het
Dclk3 G T 9: 111,467,820 R144L possibly damaging Het
Dcpp2 C T 17: 23,900,542 T110I probably damaging Het
Disp1 A T 1: 183,086,474 F1461I possibly damaging Het
Dnah1 C T 14: 31,294,874 G1562D probably damaging Het
Exoc3l2 C A 7: 19,495,359 P234Q probably damaging Het
F2rl2 T C 13: 95,701,539 V364A probably benign Het
Fam151a T C 4: 106,745,679 L265P probably damaging Het
Fam151b T A 13: 92,450,166 Q253L probably benign Het
Fat1 G A 8: 44,953,244 V1011M probably benign Het
Fbxo6 G A 4: 148,145,984 R274* probably null Het
Fgd4 G T 16: 16,484,473 Q73K probably benign Het
Fth1 A G 19: 9,984,853 T154A probably benign Het
Hgs C A 11: 120,480,040 H572Q probably benign Het
Kcnk10 G A 12: 98,489,948 T208I probably damaging Het
Kdm5b G A 1: 134,624,897 V1204M probably damaging Het
Keg1 A C 19: 12,718,821 H166P probably damaging Het
Kifap3 A T 1: 163,825,859 N338I possibly damaging Het
Llcfc1 A T 6: 41,685,284 D74V probably damaging Het
Lman2 A G 13: 55,351,405 V219A possibly damaging Het
Mettl25 A G 10: 105,826,590 I173T possibly damaging Het
Mov10 G T 3: 104,804,546 P170Q probably damaging Het
Mtif2 G T 11: 29,536,847 A286S probably damaging Het
Mtmr10 A G 7: 64,314,249 Y244C probably damaging Het
Nbea A T 3: 56,079,993 C359S probably damaging Het
Nbr1 C T 11: 101,572,841 T633I probably benign Het
Nepn A T 10: 52,400,416 T22S probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Oacyl T A 18: 65,737,972 L342M probably damaging Het
Olfr691 T A 7: 105,337,256 R153S probably damaging Het
Olfr699 A G 7: 106,790,333 F223L probably benign Het
Olfr775 T A 10: 129,251,143 I203N possibly damaging Het
Olfr872 G A 9: 20,260,724 V295I possibly damaging Het
Oxnad1 T C 14: 32,099,633 probably null Het
Pard3b A T 1: 62,166,367 D440V probably damaging Het
Pou3f2 T G 4: 22,486,960 D391A possibly damaging Het
Ptprk T C 10: 28,263,516 V79A probably benign Het
Rwdd2a A G 9: 86,574,278 D169G probably damaging Het
Scn3b A C 9: 40,279,496 D74A probably damaging Het
Setbp1 C T 18: 79,086,835 D61N probably damaging Het
Setx T A 2: 29,162,992 D2089E probably damaging Het
Vmn2r69 C G 7: 85,406,874 W685C probably damaging Het
Vps8 A G 16: 21,581,598 Q1272R probably benign Het
Wnk4 T C 11: 101,269,636 F699L probably damaging Het
Zfp616 T A 11: 74,083,977 N448K possibly damaging Het
Zfp618 C A 4: 63,115,448 D307E possibly damaging Het
Zfp687 A G 3: 95,007,533 F1219S probably damaging Het
Zfpm2 T A 15: 41,099,291 D248E probably damaging Het
Other mutations in Bcl2l14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Bcl2l14 APN 6 134423865 missense probably damaging 1.00
IGL02451:Bcl2l14 APN 6 134423841 missense probably benign 0.18
R1115:Bcl2l14 UTSW 6 134432139 splice site probably benign
R1952:Bcl2l14 UTSW 6 134432366 missense probably damaging 1.00
R3932:Bcl2l14 UTSW 6 134423808 missense probably damaging 0.98
R3933:Bcl2l14 UTSW 6 134423808 missense probably damaging 0.98
R5772:Bcl2l14 UTSW 6 134427399 missense probably damaging 0.98
R6295:Bcl2l14 UTSW 6 134427407 missense probably benign 0.40
R7078:Bcl2l14 UTSW 6 134423823 missense probably damaging 0.98
X0062:Bcl2l14 UTSW 6 134427371 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGAAGACTGTCCCGCTTCAAAC -3'
(R):5'- GGTCTCCATCGTGTTGCCTTCAAG -3'

Sequencing Primer
(F):5'- CACAAACTCCTGGGCATAGTC -3'
(R):5'- GGCTGAGATTCCCAATTTGC -3'
Posted On2014-03-28