Incidental Mutation 'R1482:Anxa2'
ID164452
Institutional Source Beutler Lab
Gene Symbol Anxa2
Ensembl Gene ENSMUSG00000032231
Gene Nameannexin A2
Synonymslipocortin II, annexin II, Cal1h, 36-kDa calelectrin
MMRRC Submission 039535-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1482 (G1)
Quality Score178
Status Not validated
Chromosome9
Chromosomal Location69453620-69491795 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCCC to TCC at 69489754 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034756] [ENSMUST00000123470] [ENSMUST00000136282]
Predicted Effect probably null
Transcript: ENSMUST00000034756
SMART Domains Protein: ENSMUSP00000034756
Gene: ENSMUSG00000032231

DomainStartEndE-ValueType
ANX 50 102 5.79e-20 SMART
ANX 122 174 1.5e-27 SMART
ANX 207 259 8.2e-11 SMART
ANX 282 334 1.6e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123470
SMART Domains Protein: ENSMUSP00000122175
Gene: ENSMUSG00000032231

DomainStartEndE-ValueType
ANX 50 102 5.79e-20 SMART
ANX 122 174 1.5e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000136282
SMART Domains Protein: ENSMUSP00000117855
Gene: ENSMUSG00000032231

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
ANX 55 107 1.5e-27 SMART
ANX 140 192 8.2e-11 SMART
ANX 215 267 1.6e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154591
Meta Mutation Damage Score 0.6384 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 83.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. This protein functions as an autocrine factor which heightens osteoclast formation and bone resorption. This gene has three pseudogenes located on chromosomes 4, 9 and 10, respectively. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are viable and fertile but suffer from growth deficits, impaired angiogenesis, and increased susceptibility to thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik G A 19: 3,717,192 D260N probably benign Het
AI314180 T C 4: 58,820,163 K1217E possibly damaging Het
Ankef1 A T 2: 136,550,158 K422N possibly damaging Het
Aqp6 A T 15: 99,604,307 *294C probably null Het
Baz2a T A 10: 128,109,008 M38K possibly damaging Het
Bcl2l14 A G 6: 134,427,302 D151G probably damaging Het
Cabp5 T A 7: 13,398,342 L12* probably null Het
Cachd1 T C 4: 100,988,598 V993A possibly damaging Het
Cd44 G A 2: 102,831,383 T306I probably damaging Het
Cdc20 A T 4: 118,437,056 N22K probably benign Het
Cdc6 T A 11: 98,916,981 D433E possibly damaging Het
Clhc1 A G 11: 29,553,725 D47G probably damaging Het
Csf2 T C 11: 54,248,563 K65E probably benign Het
Cul9 T C 17: 46,508,547 E2005G probably damaging Het
Dclk3 G T 9: 111,467,820 R144L possibly damaging Het
Dcpp2 C T 17: 23,900,542 T110I probably damaging Het
Disp1 A T 1: 183,086,474 F1461I possibly damaging Het
Dnah1 C T 14: 31,294,874 G1562D probably damaging Het
Exoc3l2 C A 7: 19,495,359 P234Q probably damaging Het
F2rl2 T C 13: 95,701,539 V364A probably benign Het
Fam151a T C 4: 106,745,679 L265P probably damaging Het
Fam151b T A 13: 92,450,166 Q253L probably benign Het
Fat1 G A 8: 44,953,244 V1011M probably benign Het
Fbxo6 G A 4: 148,145,984 R274* probably null Het
Fgd4 G T 16: 16,484,473 Q73K probably benign Het
Fth1 A G 19: 9,984,853 T154A probably benign Het
Hgs C A 11: 120,480,040 H572Q probably benign Het
Kcnk10 G A 12: 98,489,948 T208I probably damaging Het
Kdm5b G A 1: 134,624,897 V1204M probably damaging Het
Keg1 A C 19: 12,718,821 H166P probably damaging Het
Kifap3 A T 1: 163,825,859 N338I probably damaging Het
Llcfc1 A T 6: 41,685,284 D74V probably damaging Het
Lman2 A G 13: 55,351,405 V219A possibly damaging Het
Mettl25 A G 10: 105,826,590 I173T possibly damaging Het
Mov10 G T 3: 104,804,546 P170Q probably damaging Het
Mtif2 G T 11: 29,536,847 A286S probably damaging Het
Mtmr10 A G 7: 64,314,249 Y244C probably damaging Het
Nbea A T 3: 56,079,993 C359S probably damaging Het
Nbr1 C T 11: 101,572,841 T633I probably benign Het
Nepn A T 10: 52,400,416 T22S probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Oacyl T A 18: 65,737,972 L342M probably damaging Het
Olfr691 T A 7: 105,337,256 R153S probably damaging Het
Olfr699 A G 7: 106,790,333 F223L probably benign Het
Olfr775 T A 10: 129,251,143 I203N possibly damaging Het
Olfr872 G A 9: 20,260,724 V295I possibly damaging Het
Oxnad1 T C 14: 32,099,633 probably null Het
Pard3b A T 1: 62,166,367 D440V probably damaging Het
Pou3f2 T G 4: 22,486,960 D391A possibly damaging Het
Ptprk T C 10: 28,263,516 V79A probably benign Het
Rwdd2a A G 9: 86,574,278 D169G probably damaging Het
Scn3b A C 9: 40,279,496 D74A probably damaging Het
Setbp1 C T 18: 79,086,835 D61N probably damaging Het
Setx T A 2: 29,162,992 D2089E probably damaging Het
Vmn2r69 C G 7: 85,406,874 W685C probably damaging Het
Vps8 A G 16: 21,581,598 Q1272R probably benign Het
Wnk4 T C 11: 101,269,636 F699L probably damaging Het
Zfp616 T A 11: 74,083,977 N448K possibly damaging Het
Zfp618 C A 4: 63,115,448 D307E possibly damaging Het
Zfp687 A G 3: 95,007,533 F1219S probably damaging Het
Zfpm2 T A 15: 41,099,291 D248E probably damaging Het
Other mutations in Anxa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Anxa2 APN 9 69483019 nonsense probably null
IGL02550:Anxa2 APN 9 69467306 missense probably benign 0.00
FR4342:Anxa2 UTSW 9 69480205 small insertion probably benign
FR4342:Anxa2 UTSW 9 69480210 small insertion probably benign
FR4548:Anxa2 UTSW 9 69480203 small insertion probably benign
FR4589:Anxa2 UTSW 9 69480210 small insertion probably benign
R1480:Anxa2 UTSW 9 69489754 frame shift probably null
R1519:Anxa2 UTSW 9 69485241 missense probably damaging 1.00
R1609:Anxa2 UTSW 9 69489754 frame shift probably null
R1610:Anxa2 UTSW 9 69489754 frame shift probably null
R1624:Anxa2 UTSW 9 69479708 missense probably benign 0.10
R1672:Anxa2 UTSW 9 69489754 frame shift probably null
R1696:Anxa2 UTSW 9 69489754 frame shift probably null
R1760:Anxa2 UTSW 9 69489767 missense probably benign 0.00
R1775:Anxa2 UTSW 9 69488081 missense possibly damaging 0.93
R1828:Anxa2 UTSW 9 69482978 missense probably damaging 1.00
R1884:Anxa2 UTSW 9 69489754 frame shift probably null
R1991:Anxa2 UTSW 9 69483816 missense probably damaging 1.00
R2020:Anxa2 UTSW 9 69483817 missense probably damaging 0.99
R2029:Anxa2 UTSW 9 69464480 missense possibly damaging 0.71
R2103:Anxa2 UTSW 9 69483816 missense probably damaging 1.00
R2129:Anxa2 UTSW 9 69476128 missense possibly damaging 0.48
R2146:Anxa2 UTSW 9 69489754 frame shift probably null
R2148:Anxa2 UTSW 9 69489754 frame shift probably null
R2149:Anxa2 UTSW 9 69489754 frame shift probably null
R2150:Anxa2 UTSW 9 69489754 frame shift probably null
R2437:Anxa2 UTSW 9 69489764 missense probably damaging 1.00
R3848:Anxa2 UTSW 9 69467342 missense probably damaging 1.00
R4036:Anxa2 UTSW 9 69488070 missense probably damaging 0.99
R4565:Anxa2 UTSW 9 69489737 missense probably damaging 1.00
R4731:Anxa2 UTSW 9 69486530 missense probably benign 0.41
R5172:Anxa2 UTSW 9 69485251 missense probably damaging 0.99
R5181:Anxa2 UTSW 9 69476065 missense probably benign 0.00
R6427:Anxa2 UTSW 9 69476149 critical splice donor site probably null
R6759:Anxa2 UTSW 9 69483821 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACGACCCACATGAGTGCAG -3'
(R):5'- TGGTGCCCAGAGTCTATTCTCTACG -3'

Sequencing Primer
(F):5'- gctgctgttgtcgaaatcc -3'
(R):5'- cacatacacatatacacacccac -3'
Posted On2014-03-28