Incidental Mutation 'R1482:Aqp6'
List |< first << previous [record 58 of 958] next >> last >|
ID164479
Institutional Source Beutler Lab
Gene Symbol Aqp6
Ensembl Gene ENSMUSG00000043144
Gene Nameaquaporin 6
Synonyms
MMRRC Submission 039535-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1482 (G1)
Quality Score142
Status Not validated
Chromosome15
Chromosomal Location99601400-99605477 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to T at 99604307 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Cysteine at position 294 (*294C)
Ref Sequence ENSEMBL: ENSMUSP00000023754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023754] [ENSMUST00000230075]
Predicted Effect probably null
Transcript: ENSMUST00000023754
AA Change: *294C
SMART Domains Protein: ENSMUSP00000023754
Gene: ENSMUSG00000043144
AA Change: *294C

DomainStartEndE-ValueType
Pfam:MIP 17 228 2.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230075
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 83.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an aquaporin protein, which functions as a water channel in cells. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein (MIP or AQP0). This protein is specific for the kidney. This gene and related family members AQP0, AQP2, and AQP5 reside in a cluster on chromosome 12q13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik G A 19: 3,717,192 D260N probably benign Het
AI314180 T C 4: 58,820,163 K1217E possibly damaging Het
Ankef1 A T 2: 136,550,158 K422N possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Baz2a T A 10: 128,109,008 M38K possibly damaging Het
Bcl2l14 A G 6: 134,427,302 D151G probably damaging Het
Cabp5 T A 7: 13,398,342 L12* probably null Het
Cachd1 T C 4: 100,988,598 V993A possibly damaging Het
Cd44 G A 2: 102,831,383 T306I probably damaging Het
Cdc20 A T 4: 118,437,056 N22K probably benign Het
Cdc6 T A 11: 98,916,981 D433E possibly damaging Het
Clhc1 A G 11: 29,553,725 D47G probably damaging Het
Csf2 T C 11: 54,248,563 K65E probably benign Het
Cul9 T C 17: 46,508,547 E2005G probably damaging Het
Dclk3 G T 9: 111,467,820 R144L possibly damaging Het
Dcpp2 C T 17: 23,900,542 T110I probably damaging Het
Disp1 A T 1: 183,086,474 F1461I possibly damaging Het
Dnah1 C T 14: 31,294,874 G1562D probably damaging Het
Exoc3l2 C A 7: 19,495,359 P234Q probably damaging Het
F2rl2 T C 13: 95,701,539 V364A probably benign Het
Fam151a T C 4: 106,745,679 L265P probably damaging Het
Fam151b T A 13: 92,450,166 Q253L probably benign Het
Fat1 G A 8: 44,953,244 V1011M probably benign Het
Fbxo6 G A 4: 148,145,984 R274* probably null Het
Fgd4 G T 16: 16,484,473 Q73K probably benign Het
Fth1 A G 19: 9,984,853 T154A probably benign Het
Hgs C A 11: 120,480,040 H572Q probably benign Het
Kcnk10 G A 12: 98,489,948 T208I probably damaging Het
Kdm5b G A 1: 134,624,897 V1204M probably damaging Het
Keg1 A C 19: 12,718,821 H166P probably damaging Het
Kifap3 A T 1: 163,825,859 N338I probably damaging Het
Llcfc1 A T 6: 41,685,284 D74V probably damaging Het
Lman2 A G 13: 55,351,405 V219A possibly damaging Het
Mettl25 A G 10: 105,826,590 I173T possibly damaging Het
Mov10 G T 3: 104,804,546 P170Q probably damaging Het
Mtif2 G T 11: 29,536,847 A286S probably damaging Het
Mtmr10 A G 7: 64,314,249 Y244C probably damaging Het
Nbea A T 3: 56,079,993 C359S probably damaging Het
Nbr1 C T 11: 101,572,841 T633I probably benign Het
Nepn A T 10: 52,400,416 T22S probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Oacyl T A 18: 65,737,972 L342M probably damaging Het
Olfr691 T A 7: 105,337,256 R153S probably damaging Het
Olfr699 A G 7: 106,790,333 F223L probably benign Het
Olfr775 T A 10: 129,251,143 I203N possibly damaging Het
Olfr872 G A 9: 20,260,724 V295I possibly damaging Het
Oxnad1 T C 14: 32,099,633 probably null Het
Pard3b A T 1: 62,166,367 D440V probably damaging Het
Pou3f2 T G 4: 22,486,960 D391A possibly damaging Het
Ptprk T C 10: 28,263,516 V79A probably benign Het
Rwdd2a A G 9: 86,574,278 D169G probably damaging Het
Scn3b A C 9: 40,279,496 D74A probably damaging Het
Setbp1 C T 18: 79,086,835 D61N probably damaging Het
Setx T A 2: 29,162,992 D2089E probably damaging Het
Vmn2r69 C G 7: 85,406,874 W685C probably damaging Het
Vps8 A G 16: 21,581,598 Q1272R probably benign Het
Wnk4 T C 11: 101,269,636 F699L probably damaging Het
Zfp616 T A 11: 74,083,977 N448K possibly damaging Het
Zfp618 C A 4: 63,115,448 D307E possibly damaging Het
Zfp687 A G 3: 95,007,533 F1219S probably damaging Het
Zfpm2 T A 15: 41,099,291 D248E probably damaging Het
Other mutations in Aqp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Aqp6 APN 15 99604278 missense probably benign 0.01
IGL02827:Aqp6 APN 15 99603011 missense probably damaging 1.00
R1708:Aqp6 UTSW 15 99602662 missense possibly damaging 0.92
R4324:Aqp6 UTSW 15 99601410 start codon destroyed probably null 0.08
R5756:Aqp6 UTSW 15 99602742 missense probably damaging 0.98
R5974:Aqp6 UTSW 15 99601436 missense probably benign 0.12
R6773:Aqp6 UTSW 15 99602677 missense probably damaging 0.98
X0025:Aqp6 UTSW 15 99601505 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGACCAGCTTCTGCATTCATAGAC -3'
(R):5'- CCCTGTGCTCTTGCCGTTAAGAAAC -3'

Sequencing Primer
(F):5'- CAGCTTCTGCATTCATAGACAGAAAG -3'
(R):5'- ggggggatgagggagag -3'
Posted On2014-03-28