Incidental Mutation 'R1195:Tmbim7'
ID164498
Institutional Source Beutler Lab
Gene Symbol Tmbim7
Ensembl Gene ENSMUSG00000014529
Gene Nametransmembrane BAX inhibitor motif containing 7
SynonymsLgf5, 4930403J02Rik, Tmbim1b, 4930511M11Rik, 4930500J03Rik
MMRRC Submission 039267-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.040) question?
Stock #R1195 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location3651181-3680325 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3661943 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 63 (T63A)
Ref Sequence ENSEMBL: ENSMUSP00000014673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014673] [ENSMUST00000156117] [ENSMUST00000196304] [ENSMUST00000198739] [ENSMUST00000199959]
Predicted Effect probably benign
Transcript: ENSMUST00000014673
AA Change: T63A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000014673
Gene: ENSMUSG00000014529
AA Change: T63A

DomainStartEndE-ValueType
Pfam:Bax1-I 92 300 3.6e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115515
SMART Domains Protein: ENSMUSP00000111177
Gene: ENSMUSG00000014529

DomainStartEndE-ValueType
transmembrane domain 100 122 N/A INTRINSIC
transmembrane domain 143 162 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156117
AA Change: T26A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117435
Gene: ENSMUSG00000014529
AA Change: T26A

DomainStartEndE-ValueType
Pfam:Bax1-I 55 205 2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196304
Predicted Effect probably benign
Transcript: ENSMUST00000198739
SMART Domains Protein: ENSMUSP00000143399
Gene: ENSMUSG00000014529

DomainStartEndE-ValueType
Pfam:Bax1-I 28 222 3.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199959
SMART Domains Protein: ENSMUSP00000143241
Gene: ENSMUSG00000014529

DomainStartEndE-ValueType
Pfam:Bax1-I 1 96 2.6e-7 PFAM
Meta Mutation Damage Score 0.1116 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.6%
  • 10x: 92.8%
  • 20x: 76.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AC073561.5 A T 12: 114,479,395 probably benign Het
Agtr1a C A 13: 30,381,918 P322Q probably damaging Het
Brd1 T C 15: 88,700,811 E940G probably benign Het
Cd163 T A 6: 124,325,250 probably benign Het
Cd28 C T 1: 60,763,144 T74I possibly damaging Het
Cntnap2 T A 6: 46,483,968 M646K probably benign Het
Cyb5d1 C T 11: 69,394,971 probably null Het
D430042O09Rik A G 7: 125,866,482 R1343G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dab2ip T C 2: 35,718,745 probably benign Het
Dst A G 1: 34,211,154 D4063G probably damaging Het
Elmod1 T C 9: 53,935,768 Y42C probably damaging Het
Fam129b T C 2: 32,919,803 V304A probably benign Het
Hdac5 T C 11: 102,205,506 I310V probably damaging Het
Hpx A G 7: 105,599,649 probably benign Het
Igsf3 A G 3: 101,458,103 D1130G probably benign Het
Kdm4d A G 9: 14,463,099 S488P probably benign Het
Lingo2 A G 4: 35,708,538 Y481H probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k20 C T 2: 72,438,218 P523L probably damaging Het
Myo9a A G 9: 59,895,200 D1990G probably damaging Het
Perp C A 10: 18,855,735 Y147* probably null Het
Prr16 A T 18: 51,302,683 D78V probably damaging Het
Rfx7 C T 9: 72,617,946 T806M probably damaging Het
Robo2 T C 16: 73,916,128 probably null Het
Spdl1 T C 11: 34,819,817 Y368C probably damaging Het
Sptbn2 G C 19: 4,745,893 R1700P possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tln2 T G 9: 67,258,566 K1000Q probably damaging Het
Tmed11 T C 5: 108,779,019 D129G possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttll6 T C 11: 96,135,729 I113T probably damaging Het
Uso1 T A 5: 92,170,747 F210L probably damaging Het
Uspl1 T A 5: 149,194,321 V224E probably benign Het
Zfp639 G A 3: 32,519,196 V86I possibly damaging Het
Other mutations in Tmbim7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Tmbim7 APN 5 3679087 missense probably damaging 1.00
IGL01712:Tmbim7 APN 5 3670074 missense probably damaging 1.00
IGL03003:Tmbim7 APN 5 3661887 missense probably benign 0.39
IGL03115:Tmbim7 APN 5 3679158 makesense probably null
FR4340:Tmbim7 UTSW 5 3670064 missense possibly damaging 0.50
FR4342:Tmbim7 UTSW 5 3670064 missense possibly damaging 0.50
FR4589:Tmbim7 UTSW 5 3670064 missense possibly damaging 0.50
R0241:Tmbim7 UTSW 5 3666866 missense probably benign 0.15
R0241:Tmbim7 UTSW 5 3666866 missense probably benign 0.15
R1195:Tmbim7 UTSW 5 3661943 missense probably benign 0.00
R1195:Tmbim7 UTSW 5 3661943 missense probably benign 0.00
R1462:Tmbim7 UTSW 5 3664304 missense probably damaging 1.00
R1462:Tmbim7 UTSW 5 3664304 missense probably damaging 1.00
R1590:Tmbim7 UTSW 5 3665338 splice site probably null
R1795:Tmbim7 UTSW 5 3657493 unclassified probably null
R2919:Tmbim7 UTSW 5 3673188 critical splice donor site probably null
R3896:Tmbim7 UTSW 5 3661916 missense probably benign 0.00
R4353:Tmbim7 UTSW 5 3661796 missense probably benign 0.00
R4930:Tmbim7 UTSW 5 3661948 nonsense probably null
R5277:Tmbim7 UTSW 5 3673192 splice site probably null
R6475:Tmbim7 UTSW 5 3664319 missense probably benign 0.04
R6633:Tmbim7 UTSW 5 3657659 intron probably null
R6835:Tmbim7 UTSW 5 3661943 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TTGGAGGTCAGTGAGCCAGTCAAC -3'
(R):5'- CACAGCATTGCCCTTAGCTACTGTC -3'

Sequencing Primer
(F):5'- GTGAGCCAGTCAACTTTAGC -3'
(R):5'- ATGGCAGCCTTTGACACATC -3'
Posted On2014-03-28