Incidental Mutation 'R1467:Pcif1'
ID164551
Institutional Source Beutler Lab
Gene Symbol Pcif1
Ensembl Gene ENSMUSG00000039849
Gene NamePDX1 C-terminal inhibiting factor 1
Synonyms
MMRRC Submission 039520-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R1467 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location164879304-164894454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 164889138 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 404 (Y404H)
Ref Sequence ENSEMBL: ENSMUSP00000039555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000041643] [ENSMUST00000183830]
Predicted Effect probably benign
Transcript: ENSMUST00000041361
SMART Domains Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
ZnF_C2H2 591 613 2.53e-2 SMART
ZnF_C2H2 622 644 6.78e-3 SMART
ZnF_C2H2 650 673 8.22e-2 SMART
ZnF_C2H2 679 702 3.29e-1 SMART
low complexity region 711 726 N/A INTRINSIC
internal_repeat_3 770 937 7.16e-5 PROSPERO
low complexity region 1005 1015 N/A INTRINSIC
ZnF_C2H2 1019 1041 2.95e-3 SMART
ZnF_C2H2 1047 1069 5.5e-3 SMART
ZnF_C2H2 1075 1097 1.58e-3 SMART
ZnF_C2H2 1103 1126 3.34e-2 SMART
low complexity region 1288 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041643
AA Change: Y404H

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000039555
Gene: ENSMUSG00000039849
AA Change: Y404H

DomainStartEndE-ValueType
WW 44 77 4.34e-4 SMART
low complexity region 132 148 N/A INTRINSIC
Pfam:PCIF1_WW 445 620 7.1e-74 PFAM
low complexity region 675 686 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130213
Predicted Effect probably benign
Transcript: ENSMUST00000183830
SMART Domains Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.1%
  • 10x: 88.5%
  • 20x: 62.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C A 9: 124,295,463 V9L possibly damaging Het
4932438A13Rik T A 3: 37,035,945 V676D probably damaging Het
A630010A05Rik C A 16: 14,618,583 L167I possibly damaging Het
Abca14 A T 7: 120,216,182 M218L possibly damaging Het
Abca15 C A 7: 120,340,538 probably null Het
Acod1 T C 14: 103,054,567 F176L probably benign Het
Actr5 A G 2: 158,638,697 H545R probably benign Het
Adcy1 A G 11: 7,138,396 T472A probably damaging Het
AI314180 A G 4: 58,832,753 V869A probably benign Het
Aldh1l1 A G 6: 90,571,928 K469R possibly damaging Het
Ambra1 A T 2: 91,885,703 Q853L probably damaging Het
Apol7e G T 15: 77,717,766 G188V probably damaging Het
AU018091 A T 7: 3,164,259 W43R probably benign Het
Baat A G 4: 49,503,101 V7A probably benign Het
Bcas1 C A 2: 170,387,932 Q249H possibly damaging Het
Bptf G T 11: 107,055,055 Q2453K possibly damaging Het
Btg3 A G 16: 78,364,800 probably null Het
Cacna2d3 T C 14: 29,333,779 N298S possibly damaging Het
Carf G A 1: 60,127,993 V127I possibly damaging Het
Catsperg1 T C 7: 29,185,008 S916G probably damaging Het
Cers1 T C 8: 70,323,169 S274P possibly damaging Het
Ces4a T A 8: 105,138,035 V48E possibly damaging Het
Cfap54 T A 10: 92,969,763 H1495L probably benign Het
Cntnap5a T A 1: 115,685,168 L11* probably null Het
Cr2 C T 1: 195,157,509 G913R probably damaging Het
Cul9 A G 17: 46,525,373 L1155P probably damaging Het
Dlec1 A T 9: 119,142,578 D1278V probably damaging Het
Dmrt2 A G 19: 25,673,606 E52G possibly damaging Het
Dsp A G 13: 38,192,712 K1491R probably benign Het
Eef1d A T 15: 75,895,921 D206E probably damaging Het
Erbb2 C T 11: 98,436,175 Q1137* probably null Het
Ercc2 T A 7: 19,385,886 D157E probably benign Het
Eri1 A G 8: 35,469,130 *346Q probably null Het
Espl1 A G 15: 102,319,858 E1689G probably benign Het
Fam35a G T 14: 34,268,662 H96N possibly damaging Het
Fap C T 2: 62,517,620 V539I probably benign Het
Fasn A G 11: 120,811,040 F1871S probably benign Het
Gabpb1 T G 2: 126,652,327 Y126S probably damaging Het
Gm8879 C T 5: 11,130,370 H82Y probably damaging Het
Grm1 T C 10: 10,719,958 Y642C probably damaging Het
Heatr4 T C 12: 83,978,067 T327A possibly damaging Het
Hmbox1 T C 14: 64,861,578 D212G possibly damaging Het
Hmcn1 T A 1: 150,689,590 D2262V probably damaging Het
Hoxb9 A G 11: 96,271,938 T133A probably benign Het
Insr A T 8: 3,169,720 V934E probably damaging Het
Ipo9 T C 1: 135,406,543 E315G possibly damaging Het
Itga10 C T 3: 96,652,229 Q481* probably null Het
Kntc1 T A 5: 123,786,984 M1120K probably benign Het
Krt78 A G 15: 101,946,293 Y1028H possibly damaging Het
Lrrc38 A T 4: 143,369,880 I254F probably damaging Het
Lyrm7 A G 11: 54,850,389 F40L probably damaging Het
Mfsd4b1 C T 10: 40,002,635 S422N possibly damaging Het
Mlh3 A T 12: 85,237,600 L1380* probably null Het
Mrpl24 C A 3: 87,922,437 A110D probably benign Het
Mrps14 T C 1: 160,196,950 V17A probably benign Het
Mtcl1 T C 17: 66,448,327 D340G probably damaging Het
Neb T C 2: 52,230,047 Y3900C probably damaging Het
Neurod4 T C 10: 130,270,604 D267G probably benign Het
Nf1 A T 11: 79,428,626 I536F possibly damaging Het
Nkg7 C T 7: 43,437,433 P44S probably damaging Het
Olfr1200 T C 2: 88,767,488 I276V probably benign Het
Olfr293 T C 7: 86,663,977 V105A possibly damaging Het
Pcnx2 A T 8: 125,753,550 L2006Q possibly damaging Het
Pcnx3 A T 19: 5,674,894 S821T possibly damaging Het
Pde8b T A 13: 95,034,172 D662V probably damaging Het
Pkd1l3 C T 8: 109,616,368 P113S unknown Het
Pkd2l1 G T 19: 44,154,209 Q465K possibly damaging Het
Plch2 G T 4: 154,983,732 P1479Q probably benign Het
Plekhm3 A T 1: 64,892,882 I521N probably damaging Het
Pola2 A T 19: 5,942,065 Y526* probably null Het
Prss23 T C 7: 89,510,009 D284G probably damaging Het
Psme2b A G 11: 48,945,640 F160S probably damaging Het
Rap1gap2 A G 11: 74,437,027 V139A possibly damaging Het
Rbbp9 G T 2: 144,543,857 R163S possibly damaging Het
Rdh12 T C 12: 79,213,748 L206P probably damaging Het
Rhou T C 8: 123,661,290 W254R possibly damaging Het
Scfd1 A G 12: 51,431,498 K498E possibly damaging Het
Scn7a A G 2: 66,689,558 Y1001H probably benign Het
Setx T A 2: 29,158,905 V1981E probably damaging Het
Sfxn1 T C 13: 54,093,871 I205T possibly damaging Het
Spock1 G A 13: 57,429,369 R416C possibly damaging Het
Spred2 A G 11: 20,018,109 I222V probably benign Het
Stkld1 A T 2: 26,949,395 T358S probably benign Het
Strip1 T C 3: 107,627,408 E102G possibly damaging Het
Tarsl2 T C 7: 65,655,696 S223P probably damaging Het
Tdpoz1 T A 3: 93,671,330 E49V probably benign Het
Tert A G 13: 73,628,209 T360A probably benign Het
Tspear A G 10: 77,881,192 Y567C probably damaging Het
Ttc28 A G 5: 111,285,388 Q2096R probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn2r111 T A 17: 22,571,047 H326L probably damaging Het
Vmn2r18 A G 5: 151,586,836 F24S possibly damaging Het
Vmn2r82 A T 10: 79,396,299 I711F probably benign Het
Vwa8 C T 14: 79,103,694 Q1537* probably null Het
Wdr64 G A 1: 175,775,722 V630I probably benign Het
Wnt6 G T 1: 74,782,275 W84L probably damaging Het
Zfp11 C A 5: 129,658,190 R69L probably benign Het
Other mutations in Pcif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Pcif1 APN 2 164885788 missense probably damaging 1.00
IGL01598:Pcif1 APN 2 164886611 missense possibly damaging 0.86
R0313:Pcif1 UTSW 2 164884419 missense probably damaging 0.97
R0329:Pcif1 UTSW 2 164889444 missense probably damaging 1.00
R0330:Pcif1 UTSW 2 164889444 missense probably damaging 1.00
R1070:Pcif1 UTSW 2 164889138 missense probably benign 0.01
R1350:Pcif1 UTSW 2 164886767 missense probably damaging 0.99
R1467:Pcif1 UTSW 2 164889138 missense probably benign 0.01
R1583:Pcif1 UTSW 2 164886727 missense probably damaging 1.00
R1640:Pcif1 UTSW 2 164885683 missense probably benign
R1852:Pcif1 UTSW 2 164888466 missense probably damaging 0.97
R2252:Pcif1 UTSW 2 164890879 missense probably benign 0.05
R2571:Pcif1 UTSW 2 164884211 missense probably damaging 1.00
R3879:Pcif1 UTSW 2 164885958 missense probably benign 0.40
R4956:Pcif1 UTSW 2 164889690 missense probably damaging 1.00
R5792:Pcif1 UTSW 2 164885379 missense probably damaging 0.97
R5913:Pcif1 UTSW 2 164884492 intron probably benign
R6798:Pcif1 UTSW 2 164885791 missense possibly damaging 0.94
R6913:Pcif1 UTSW 2 164884304 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAGTTAATGCCTGGTTGCGCTTC -3'
(R):5'- GGAACCTCTCAAAGGCAGAGTCATC -3'

Sequencing Primer
(F):5'- GCGCTTCTTAACGGTGATG -3'
(R):5'- CTATAGCGGTAGAGGAGCCAC -3'
Posted On2014-03-28