Incidental Mutation 'R1467:Ces4a'
ID164582
Institutional Source Beutler Lab
Gene Symbol Ces4a
Ensembl Gene ENSMUSG00000060560
Gene Namecarboxylesterase 4A
SynonymsCes8
MMRRC Submission 039520-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1467 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105131800-105150109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105138035 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 48 (V48E)
Ref Sequence ENSEMBL: ENSMUSP00000125062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161289]
Predicted Effect possibly damaging
Transcript: ENSMUST00000161289
AA Change: V48E

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125062
Gene: ENSMUSG00000060560
AA Change: V48E

DomainStartEndE-ValueType
Pfam:COesterase 8 554 4.9e-163 PFAM
Pfam:Abhydrolase_3 143 319 2e-9 PFAM
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.1%
  • 10x: 88.5%
  • 20x: 62.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They also participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This gene, also called CES6, encodes a secreted enzyme, and may play a role in the detoxification of drugs and xenobiotics in neural and other tissues of the body and in the cerebrospinal fluid. Multiple transcript variants encoding different isoforms have been reported, but the full-length nature and/or biological validity of some variants have not been determined. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C A 9: 124,295,463 V9L possibly damaging Het
4932438A13Rik T A 3: 37,035,945 V676D probably damaging Het
A630010A05Rik C A 16: 14,618,583 L167I possibly damaging Het
Abca14 A T 7: 120,216,182 M218L possibly damaging Het
Abca15 C A 7: 120,340,538 probably null Het
Acod1 T C 14: 103,054,567 F176L probably benign Het
Actr5 A G 2: 158,638,697 H545R probably benign Het
Adcy1 A G 11: 7,138,396 T472A probably damaging Het
AI314180 A G 4: 58,832,753 V869A probably benign Het
Aldh1l1 A G 6: 90,571,928 K469R possibly damaging Het
Ambra1 A T 2: 91,885,703 Q853L probably damaging Het
Apol7e G T 15: 77,717,766 G188V probably damaging Het
AU018091 A T 7: 3,164,259 W43R probably benign Het
Baat A G 4: 49,503,101 V7A probably benign Het
Bcas1 C A 2: 170,387,932 Q249H possibly damaging Het
Bptf G T 11: 107,055,055 Q2453K possibly damaging Het
Btg3 A G 16: 78,364,800 probably null Het
Cacna2d3 T C 14: 29,333,779 N298S possibly damaging Het
Carf G A 1: 60,127,993 V127I possibly damaging Het
Catsperg1 T C 7: 29,185,008 S916G probably damaging Het
Cers1 T C 8: 70,323,169 S274P possibly damaging Het
Cfap54 T A 10: 92,969,763 H1495L probably benign Het
Cntnap5a T A 1: 115,685,168 L11* probably null Het
Cr2 C T 1: 195,157,509 G913R probably damaging Het
Cul9 A G 17: 46,525,373 L1155P probably damaging Het
Dlec1 A T 9: 119,142,578 D1278V probably damaging Het
Dmrt2 A G 19: 25,673,606 E52G possibly damaging Het
Dsp A G 13: 38,192,712 K1491R probably benign Het
Eef1d A T 15: 75,895,921 D206E probably damaging Het
Erbb2 C T 11: 98,436,175 Q1137* probably null Het
Ercc2 T A 7: 19,385,886 D157E probably benign Het
Eri1 A G 8: 35,469,130 *346Q probably null Het
Espl1 A G 15: 102,319,858 E1689G probably benign Het
Fam35a G T 14: 34,268,662 H96N possibly damaging Het
Fap C T 2: 62,517,620 V539I probably benign Het
Fasn A G 11: 120,811,040 F1871S probably benign Het
Gabpb1 T G 2: 126,652,327 Y126S probably damaging Het
Gm8879 C T 5: 11,130,370 H82Y probably damaging Het
Grm1 T C 10: 10,719,958 Y642C probably damaging Het
Heatr4 T C 12: 83,978,067 T327A possibly damaging Het
Hmbox1 T C 14: 64,861,578 D212G possibly damaging Het
Hmcn1 T A 1: 150,689,590 D2262V probably damaging Het
Hoxb9 A G 11: 96,271,938 T133A probably benign Het
Insr A T 8: 3,169,720 V934E probably damaging Het
Ipo9 T C 1: 135,406,543 E315G possibly damaging Het
Itga10 C T 3: 96,652,229 Q481* probably null Het
Kntc1 T A 5: 123,786,984 M1120K probably benign Het
Krt78 A G 15: 101,946,293 Y1028H possibly damaging Het
Lrrc38 A T 4: 143,369,880 I254F probably damaging Het
Lyrm7 A G 11: 54,850,389 F40L probably damaging Het
Mfsd4b1 C T 10: 40,002,635 S422N possibly damaging Het
Mlh3 A T 12: 85,237,600 L1380* probably null Het
Mrpl24 C A 3: 87,922,437 A110D probably benign Het
Mrps14 T C 1: 160,196,950 V17A probably benign Het
Mtcl1 T C 17: 66,448,327 D340G probably damaging Het
Neb T C 2: 52,230,047 Y3900C probably damaging Het
Neurod4 T C 10: 130,270,604 D267G probably benign Het
Nf1 A T 11: 79,428,626 I536F possibly damaging Het
Nkg7 C T 7: 43,437,433 P44S probably damaging Het
Olfr1200 T C 2: 88,767,488 I276V probably benign Het
Olfr293 T C 7: 86,663,977 V105A possibly damaging Het
Pcif1 T C 2: 164,889,138 Y404H probably benign Het
Pcnx2 A T 8: 125,753,550 L2006Q possibly damaging Het
Pcnx3 A T 19: 5,674,894 S821T possibly damaging Het
Pde8b T A 13: 95,034,172 D662V probably damaging Het
Pkd1l3 C T 8: 109,616,368 P113S unknown Het
Pkd2l1 G T 19: 44,154,209 Q465K possibly damaging Het
Plch2 G T 4: 154,983,732 P1479Q probably benign Het
Plekhm3 A T 1: 64,892,882 I521N probably damaging Het
Pola2 A T 19: 5,942,065 Y526* probably null Het
Prss23 T C 7: 89,510,009 D284G probably damaging Het
Psme2b A G 11: 48,945,640 F160S probably damaging Het
Rap1gap2 A G 11: 74,437,027 V139A possibly damaging Het
Rbbp9 G T 2: 144,543,857 R163S possibly damaging Het
Rdh12 T C 12: 79,213,748 L206P probably damaging Het
Rhou T C 8: 123,661,290 W254R possibly damaging Het
Scfd1 A G 12: 51,431,498 K498E possibly damaging Het
Scn7a A G 2: 66,689,558 Y1001H probably benign Het
Setx T A 2: 29,158,905 V1981E probably damaging Het
Sfxn1 T C 13: 54,093,871 I205T possibly damaging Het
Spock1 G A 13: 57,429,369 R416C possibly damaging Het
Spred2 A G 11: 20,018,109 I222V probably benign Het
Stkld1 A T 2: 26,949,395 T358S probably benign Het
Strip1 T C 3: 107,627,408 E102G possibly damaging Het
Tarsl2 T C 7: 65,655,696 S223P probably damaging Het
Tdpoz1 T A 3: 93,671,330 E49V probably benign Het
Tert A G 13: 73,628,209 T360A probably benign Het
Tspear A G 10: 77,881,192 Y567C probably damaging Het
Ttc28 A G 5: 111,285,388 Q2096R probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn2r111 T A 17: 22,571,047 H326L probably damaging Het
Vmn2r18 A G 5: 151,586,836 F24S possibly damaging Het
Vmn2r82 A T 10: 79,396,299 I711F probably benign Het
Vwa8 C T 14: 79,103,694 Q1537* probably null Het
Wdr64 G A 1: 175,775,722 V630I probably benign Het
Wnt6 G T 1: 74,782,275 W84L probably damaging Het
Zfp11 C A 5: 129,658,190 R69L probably benign Het
Other mutations in Ces4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Ces4a APN 8 105145163 missense probably benign 0.00
IGL01574:Ces4a APN 8 105145227 splice site probably benign
IGL01655:Ces4a APN 8 105147174 missense probably damaging 0.99
IGL03092:Ces4a APN 8 105148204 splice site probably benign
IGL03151:Ces4a APN 8 105148197 critical splice donor site probably null
F6893:Ces4a UTSW 8 105147227 missense possibly damaging 0.74
R0266:Ces4a UTSW 8 105141966 missense probably benign
R0659:Ces4a UTSW 8 105144922 splice site probably benign
R1239:Ces4a UTSW 8 105149498 missense probably damaging 1.00
R1467:Ces4a UTSW 8 105138035 missense possibly damaging 0.56
R1505:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1509:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1598:Ces4a UTSW 8 105142821 missense probably damaging 1.00
R1734:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1736:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1737:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1738:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1744:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1789:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1951:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1953:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R2126:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R2129:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R2202:Ces4a UTSW 8 105146114 missense probably damaging 1.00
R4512:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R4865:Ces4a UTSW 8 105147158 missense probably benign 0.05
R4934:Ces4a UTSW 8 105137981 missense probably benign 0.30
R4936:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R5255:Ces4a UTSW 8 105142489 missense probably benign 0.00
R5342:Ces4a UTSW 8 105146143 missense probably benign 0.07
R5647:Ces4a UTSW 8 105146080 missense probably benign 0.10
R6062:Ces4a UTSW 8 105138174 critical splice donor site probably null
R6490:Ces4a UTSW 8 105149458 missense probably benign 0.09
R6606:Ces4a UTSW 8 105149378 missense possibly damaging 0.95
R6876:Ces4a UTSW 8 105144992 missense possibly damaging 0.56
R6901:Ces4a UTSW 8 105146698 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTACCAATATAAAGCAAGCAGCAGCAG -3'
(R):5'- GAAACCGAAGCCAAGAATAGGTTCCA -3'

Sequencing Primer
(F):5'- gggagactgggttagaagaatg -3'
(R):5'- TGAGATACTCTAGGCACTGGTCC -3'
Posted On2014-03-28