Incidental Mutation 'R1467:Pkd1l3'
ID164583
Institutional Source Beutler Lab
Gene Symbol Pkd1l3
Ensembl Gene ENSMUSG00000048827
Gene Namepolycystic kidney disease 1 like 3
Synonyms
MMRRC Submission 039520-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1467 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location109614517-109674386 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 109616368 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 113 (P113S)
Ref Sequence ENSEMBL: ENSMUSP00000148592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057344] [ENSMUST00000109242] [ENSMUST00000212537]
Predicted Effect unknown
Transcript: ENSMUST00000057344
AA Change: P113S
SMART Domains Protein: ENSMUSP00000051512
Gene: ENSMUSG00000048827
AA Change: P113S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CLECT 26 142 4.25e-1 SMART
internal_repeat_2 143 245 2.25e-8 PROSPERO
low complexity region 246 270 N/A INTRINSIC
low complexity region 272 296 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 324 348 N/A INTRINSIC
internal_repeat_1 349 431 1.22e-8 PROSPERO
internal_repeat_2 378 466 2.25e-8 PROSPERO
internal_repeat_1 518 731 1.22e-8 PROSPERO
GPS 1007 1056 3.62e-5 SMART
transmembrane domain 1075 1094 N/A INTRINSIC
LH2 1119 1238 1.01e-9 SMART
transmembrane domain 1282 1304 N/A INTRINSIC
transmembrane domain 1319 1341 N/A INTRINSIC
low complexity region 1398 1408 N/A INTRINSIC
low complexity region 1451 1460 N/A INTRINSIC
low complexity region 1484 1497 N/A INTRINSIC
transmembrane domain 1534 1556 N/A INTRINSIC
transmembrane domain 1576 1595 N/A INTRINSIC
Pfam:PKD_channel 1695 2110 2.8e-86 PFAM
Pfam:Ion_trans 1858 2114 2.9e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000109242
AA Change: P113S
SMART Domains Protein: ENSMUSP00000104865
Gene: ENSMUSG00000048827
AA Change: P113S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CLECT 26 142 4.25e-1 SMART
internal_repeat_2 143 245 2.63e-8 PROSPERO
low complexity region 246 270 N/A INTRINSIC
low complexity region 272 296 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 324 348 N/A INTRINSIC
internal_repeat_1 349 440 3.96e-14 PROSPERO
internal_repeat_2 378 466 2.63e-8 PROSPERO
internal_repeat_1 518 724 3.96e-14 PROSPERO
GPS 1017 1066 3.62e-5 SMART
transmembrane domain 1085 1104 N/A INTRINSIC
LH2 1129 1248 1.01e-9 SMART
transmembrane domain 1292 1314 N/A INTRINSIC
transmembrane domain 1329 1351 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
low complexity region 1461 1470 N/A INTRINSIC
low complexity region 1494 1507 N/A INTRINSIC
transmembrane domain 1544 1566 N/A INTRINSIC
transmembrane domain 1586 1605 N/A INTRINSIC
Pfam:PKD_channel 1705 2120 1.3e-86 PFAM
Pfam:Ion_trans 1868 2124 4.3e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000212537
AA Change: P113S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212609
Meta Mutation Damage Score 0.29 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.1%
  • 10x: 88.5%
  • 20x: 62.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores.[provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal and exhibit normal taste responsiveness in various behavioral and electrophysiological tests of taste function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C A 9: 124,295,463 V9L possibly damaging Het
4932438A13Rik T A 3: 37,035,945 V676D probably damaging Het
A630010A05Rik C A 16: 14,618,583 L167I possibly damaging Het
Abca14 A T 7: 120,216,182 M218L possibly damaging Het
Abca15 C A 7: 120,340,538 probably null Het
Acod1 T C 14: 103,054,567 F176L probably benign Het
Actr5 A G 2: 158,638,697 H545R probably benign Het
Adcy1 A G 11: 7,138,396 T472A probably damaging Het
AI314180 A G 4: 58,832,753 V869A probably benign Het
Aldh1l1 A G 6: 90,571,928 K469R possibly damaging Het
Ambra1 A T 2: 91,885,703 Q853L probably damaging Het
Apol7e G T 15: 77,717,766 G188V probably damaging Het
AU018091 A T 7: 3,164,259 W43R probably benign Het
Baat A G 4: 49,503,101 V7A probably benign Het
Bcas1 C A 2: 170,387,932 Q249H possibly damaging Het
Bptf G T 11: 107,055,055 Q2453K possibly damaging Het
Btg3 A G 16: 78,364,800 probably null Het
Cacna2d3 T C 14: 29,333,779 N298S possibly damaging Het
Carf G A 1: 60,127,993 V127I possibly damaging Het
Catsperg1 T C 7: 29,185,008 S916G probably damaging Het
Cers1 T C 8: 70,323,169 S274P possibly damaging Het
Ces4a T A 8: 105,138,035 V48E possibly damaging Het
Cfap54 T A 10: 92,969,763 H1495L probably benign Het
Cntnap5a T A 1: 115,685,168 L11* probably null Het
Cr2 C T 1: 195,157,509 G913R probably damaging Het
Cul9 A G 17: 46,525,373 L1155P probably damaging Het
Dlec1 A T 9: 119,142,578 D1278V probably damaging Het
Dmrt2 A G 19: 25,673,606 E52G possibly damaging Het
Dsp A G 13: 38,192,712 K1491R probably benign Het
Eef1d A T 15: 75,895,921 D206E probably damaging Het
Erbb2 C T 11: 98,436,175 Q1137* probably null Het
Ercc2 T A 7: 19,385,886 D157E probably benign Het
Eri1 A G 8: 35,469,130 *346Q probably null Het
Espl1 A G 15: 102,319,858 E1689G probably benign Het
Fam35a G T 14: 34,268,662 H96N possibly damaging Het
Fap C T 2: 62,517,620 V539I probably benign Het
Fasn A G 11: 120,811,040 F1871S probably benign Het
Gabpb1 T G 2: 126,652,327 Y126S probably damaging Het
Gm8879 C T 5: 11,130,370 H82Y probably damaging Het
Grm1 T C 10: 10,719,958 Y642C probably damaging Het
Heatr4 T C 12: 83,978,067 T327A possibly damaging Het
Hmbox1 T C 14: 64,861,578 D212G possibly damaging Het
Hmcn1 T A 1: 150,689,590 D2262V probably damaging Het
Hoxb9 A G 11: 96,271,938 T133A probably benign Het
Insr A T 8: 3,169,720 V934E probably damaging Het
Ipo9 T C 1: 135,406,543 E315G possibly damaging Het
Itga10 C T 3: 96,652,229 Q481* probably null Het
Kntc1 T A 5: 123,786,984 M1120K probably benign Het
Krt78 A G 15: 101,946,293 Y1028H possibly damaging Het
Lrrc38 A T 4: 143,369,880 I254F probably damaging Het
Lyrm7 A G 11: 54,850,389 F40L probably damaging Het
Mfsd4b1 C T 10: 40,002,635 S422N possibly damaging Het
Mlh3 A T 12: 85,237,600 L1380* probably null Het
Mrpl24 C A 3: 87,922,437 A110D probably benign Het
Mrps14 T C 1: 160,196,950 V17A probably benign Het
Mtcl1 T C 17: 66,448,327 D340G probably damaging Het
Neb T C 2: 52,230,047 Y3900C probably damaging Het
Neurod4 T C 10: 130,270,604 D267G probably benign Het
Nf1 A T 11: 79,428,626 I536F possibly damaging Het
Nkg7 C T 7: 43,437,433 P44S probably damaging Het
Olfr1200 T C 2: 88,767,488 I276V probably benign Het
Olfr293 T C 7: 86,663,977 V105A possibly damaging Het
Pcif1 T C 2: 164,889,138 Y404H probably benign Het
Pcnx2 A T 8: 125,753,550 L2006Q possibly damaging Het
Pcnx3 A T 19: 5,674,894 S821T possibly damaging Het
Pde8b T A 13: 95,034,172 D662V probably damaging Het
Pkd2l1 G T 19: 44,154,209 Q465K possibly damaging Het
Plch2 G T 4: 154,983,732 P1479Q probably benign Het
Plekhm3 A T 1: 64,892,882 I521N probably damaging Het
Pola2 A T 19: 5,942,065 Y526* probably null Het
Prss23 T C 7: 89,510,009 D284G probably damaging Het
Psme2b A G 11: 48,945,640 F160S probably damaging Het
Rap1gap2 A G 11: 74,437,027 V139A possibly damaging Het
Rbbp9 G T 2: 144,543,857 R163S possibly damaging Het
Rdh12 T C 12: 79,213,748 L206P probably damaging Het
Rhou T C 8: 123,661,290 W254R possibly damaging Het
Scfd1 A G 12: 51,431,498 K498E possibly damaging Het
Scn7a A G 2: 66,689,558 Y1001H probably benign Het
Setx T A 2: 29,158,905 V1981E probably damaging Het
Sfxn1 T C 13: 54,093,871 I205T possibly damaging Het
Spock1 G A 13: 57,429,369 R416C possibly damaging Het
Spred2 A G 11: 20,018,109 I222V probably benign Het
Stkld1 A T 2: 26,949,395 T358S probably benign Het
Strip1 T C 3: 107,627,408 E102G possibly damaging Het
Tarsl2 T C 7: 65,655,696 S223P probably damaging Het
Tdpoz1 T A 3: 93,671,330 E49V probably benign Het
Tert A G 13: 73,628,209 T360A probably benign Het
Tspear A G 10: 77,881,192 Y567C probably damaging Het
Ttc28 A G 5: 111,285,388 Q2096R probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Vmn2r111 T A 17: 22,571,047 H326L probably damaging Het
Vmn2r18 A G 5: 151,586,836 F24S possibly damaging Het
Vmn2r82 A T 10: 79,396,299 I711F probably benign Het
Vwa8 C T 14: 79,103,694 Q1537* probably null Het
Wdr64 G A 1: 175,775,722 V630I probably benign Het
Wnt6 G T 1: 74,782,275 W84L probably damaging Het
Zfp11 C A 5: 129,658,190 R69L probably benign Het
Other mutations in Pkd1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pkd1l3 APN 8 109630237 missense possibly damaging 0.53
IGL00562:Pkd1l3 APN 8 109656147 missense possibly damaging 0.53
IGL00563:Pkd1l3 APN 8 109656147 missense possibly damaging 0.53
IGL01061:Pkd1l3 APN 8 109638706 missense probably damaging 1.00
IGL01105:Pkd1l3 APN 8 109662241 missense possibly damaging 0.81
IGL01574:Pkd1l3 APN 8 109623771 missense probably benign 0.01
IGL01597:Pkd1l3 APN 8 109623521 missense probably benign 0.33
IGL01634:Pkd1l3 APN 8 109667525 critical splice acceptor site probably null
IGL01645:Pkd1l3 APN 8 109635302 missense possibly damaging 0.59
IGL01770:Pkd1l3 APN 8 109648502 critical splice acceptor site probably null
IGL01837:Pkd1l3 APN 8 109630166 missense possibly damaging 0.85
IGL01862:Pkd1l3 APN 8 109631276 critical splice acceptor site probably null
IGL01938:Pkd1l3 APN 8 109635301 missense probably benign 0.00
IGL01990:Pkd1l3 APN 8 109660806 missense probably damaging 1.00
IGL02056:Pkd1l3 APN 8 109631378 missense probably benign 0.14
IGL02069:Pkd1l3 APN 8 109635380 missense probably damaging 1.00
IGL02086:Pkd1l3 APN 8 109665585 missense probably damaging 1.00
IGL02152:Pkd1l3 APN 8 109669292 missense probably damaging 1.00
IGL02209:Pkd1l3 APN 8 109638664 missense probably damaging 1.00
IGL02213:Pkd1l3 APN 8 109631345 missense probably damaging 1.00
IGL02218:Pkd1l3 APN 8 109660802 missense possibly damaging 0.92
IGL02225:Pkd1l3 APN 8 109638678 missense probably damaging 1.00
IGL02252:Pkd1l3 APN 8 109631076 missense possibly damaging 0.92
IGL02351:Pkd1l3 APN 8 109646497 unclassified probably benign
IGL02358:Pkd1l3 APN 8 109646497 unclassified probably benign
IGL02369:Pkd1l3 APN 8 109616345 missense unknown
IGL02481:Pkd1l3 APN 8 109614782 missense unknown
IGL02505:Pkd1l3 APN 8 109633216 missense probably damaging 1.00
IGL02506:Pkd1l3 APN 8 109647500 missense probably damaging 1.00
IGL02535:Pkd1l3 APN 8 109640890 nonsense probably null
IGL02715:Pkd1l3 APN 8 109626826 missense probably damaging 0.96
IGL02979:Pkd1l3 APN 8 109662104 splice site probably benign
IGL03059:Pkd1l3 APN 8 109648367 missense probably damaging 1.00
IGL03090:Pkd1l3 APN 8 109655533 nonsense probably null
IGL03206:Pkd1l3 APN 8 109623713 missense probably benign 0.18
IGL03328:Pkd1l3 APN 8 109662106 splice site probably benign
PIT4453001:Pkd1l3 UTSW 8 109660801 missense probably damaging 0.99
PIT4468001:Pkd1l3 UTSW 8 109664499 missense possibly damaging 0.85
R0001:Pkd1l3 UTSW 8 109628633 splice site probably benign
R0066:Pkd1l3 UTSW 8 109620471 missense unknown
R0066:Pkd1l3 UTSW 8 109620471 missense unknown
R0233:Pkd1l3 UTSW 8 109650780 nonsense probably null
R0233:Pkd1l3 UTSW 8 109650780 nonsense probably null
R0255:Pkd1l3 UTSW 8 109638754 missense probably damaging 1.00
R0288:Pkd1l3 UTSW 8 109646499 splice site probably null
R0311:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0311:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0403:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0403:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0441:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0446:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0465:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0465:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0466:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0467:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0468:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0488:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0488:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0515:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0534:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0650:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0689:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R1422:Pkd1l3 UTSW 8 109621708 missense unknown
R1464:Pkd1l3 UTSW 8 109636427 splice site probably benign
R1467:Pkd1l3 UTSW 8 109616368 missense unknown
R1469:Pkd1l3 UTSW 8 109646953 missense possibly damaging 0.72
R1469:Pkd1l3 UTSW 8 109646953 missense possibly damaging 0.72
R1509:Pkd1l3 UTSW 8 109640770 missense probably damaging 0.99
R1561:Pkd1l3 UTSW 8 109614813 missense unknown
R1574:Pkd1l3 UTSW 8 109614813 missense unknown
R1599:Pkd1l3 UTSW 8 109636384 missense probably benign 0.01
R1688:Pkd1l3 UTSW 8 109623818 missense probably benign 0.18
R1792:Pkd1l3 UTSW 8 109632605 missense probably damaging 1.00
R1818:Pkd1l3 UTSW 8 109648406 missense probably benign 0.03
R1896:Pkd1l3 UTSW 8 109624199 missense possibly damaging 0.92
R2105:Pkd1l3 UTSW 8 109647573 nonsense probably null
R2185:Pkd1l3 UTSW 8 109633195 missense possibly damaging 0.95
R2192:Pkd1l3 UTSW 8 109620524 missense unknown
R2260:Pkd1l3 UTSW 8 109623636 missense probably benign 0.18
R2363:Pkd1l3 UTSW 8 109628709 missense probably benign 0.01
R2418:Pkd1l3 UTSW 8 109670721 makesense probably null
R2435:Pkd1l3 UTSW 8 109650702 missense probably benign 0.07
R2443:Pkd1l3 UTSW 8 109623815 missense probably benign 0.18
R2850:Pkd1l3 UTSW 8 109623990 missense possibly damaging 0.92
R2910:Pkd1l3 UTSW 8 109667636 splice site probably benign
R3755:Pkd1l3 UTSW 8 109632539 missense probably damaging 1.00
R3791:Pkd1l3 UTSW 8 109636317 missense probably damaging 0.99
R3905:Pkd1l3 UTSW 8 109646879 missense probably benign 0.02
R4027:Pkd1l3 UTSW 8 109623971 missense possibly damaging 0.68
R4028:Pkd1l3 UTSW 8 109623971 missense possibly damaging 0.68
R4029:Pkd1l3 UTSW 8 109623971 missense possibly damaging 0.68
R4274:Pkd1l3 UTSW 8 109624119 missense possibly damaging 0.92
R4461:Pkd1l3 UTSW 8 109632713 intron probably null
R4893:Pkd1l3 UTSW 8 109638394 missense probably benign 0.15
R4907:Pkd1l3 UTSW 8 109640843 missense probably damaging 0.99
R5037:Pkd1l3 UTSW 8 109665636 missense probably damaging 1.00
R5045:Pkd1l3 UTSW 8 109623155 missense unknown
R5207:Pkd1l3 UTSW 8 109633191 missense probably damaging 1.00
R5307:Pkd1l3 UTSW 8 109640792 missense probably damaging 1.00
R5408:Pkd1l3 UTSW 8 109667052 missense probably damaging 1.00
R5595:Pkd1l3 UTSW 8 109655520 missense probably damaging 1.00
R5615:Pkd1l3 UTSW 8 109630210 missense probably benign
R5623:Pkd1l3 UTSW 8 109623719 missense possibly damaging 0.53
R5896:Pkd1l3 UTSW 8 109626836 missense probably damaging 1.00
R6101:Pkd1l3 UTSW 8 109640846 missense probably damaging 1.00
R6105:Pkd1l3 UTSW 8 109640846 missense probably damaging 1.00
R6170:Pkd1l3 UTSW 8 109623179 missense unknown
R6330:Pkd1l3 UTSW 8 109646909 missense probably benign 0.00
R6346:Pkd1l3 UTSW 8 109631384 missense probably damaging 0.98
R6395:Pkd1l3 UTSW 8 109623963 missense probably benign 0.20
R6475:Pkd1l3 UTSW 8 109623212 missense unknown
R6480:Pkd1l3 UTSW 8 109638387 nonsense probably null
R6519:Pkd1l3 UTSW 8 109628772 missense probably benign
R6654:Pkd1l3 UTSW 8 109624283 missense probably benign 0.23
R6717:Pkd1l3 UTSW 8 109614769 missense unknown
R6733:Pkd1l3 UTSW 8 109648494 splice site probably null
R6753:Pkd1l3 UTSW 8 109624449 missense probably damaging 1.00
R6777:Pkd1l3 UTSW 8 109626814 missense probably benign 0.00
R6901:Pkd1l3 UTSW 8 109614614 missense unknown
R6975:Pkd1l3 UTSW 8 109660907 missense possibly damaging 0.73
R6991:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7018:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7083:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7139:Pkd1l3 UTSW 8 109636340 missense probably damaging 0.96
R7153:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7235:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7238:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7252:Pkd1l3 UTSW 8 109660698 missense probably benign 0.01
R7296:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7309:Pkd1l3 UTSW 8 109648261 synonymous probably null
R7362:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7462:Pkd1l3 UTSW 8 109628777 missense probably benign 0.00
R7470:Pkd1l3 UTSW 8 109638376 missense probably benign 0.09
R7478:Pkd1l3 UTSW 8 109633315 missense probably damaging 1.00
R7483:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7516:Pkd1l3 UTSW 8 109635229 missense probably damaging 1.00
R7537:Pkd1l3 UTSW 8 109623788 small deletion probably benign
R7553:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7559:Pkd1l3 UTSW 8 109624440 missense probably benign 0.03
X0026:Pkd1l3 UTSW 8 109614553 missense probably null
Z31818:Pkd1l3 UTSW 8 109669292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGCCAGACAAGTTGGGCAT -3'
(R):5'- TCCACAGGCAAACAGGACAAGTTAAA -3'

Sequencing Primer
(F):5'- tcctccttccttcacctcc -3'
(R):5'- ccctctgctgctgtgtc -3'
Posted On2014-03-28