Incidental Mutation 'R1468:Crbn'
ID164668
Institutional Source Beutler Lab
Gene Symbol Crbn
Ensembl Gene ENSMUSG00000005362
Gene Namecereblon
Synonyms
MMRRC Submission 039521-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.439) question?
Stock #R1468 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location106780201-106800077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106790843 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 229 (K229E)
Ref Sequence ENSEMBL: ENSMUSP00000108865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013882] [ENSMUST00000113239] [ENSMUST00000151484]
Predicted Effect probably benign
Transcript: ENSMUST00000013882
AA Change: K228E

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000013882
Gene: ENSMUSG00000005362
AA Change: K228E

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
LON 82 319 2.33e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049675
AA Change: K229E

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000061604
Gene: ENSMUSG00000005362
AA Change: K229E

DomainStartEndE-ValueType
low complexity region 24 40 N/A INTRINSIC
LON 83 320 2.33e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113239
AA Change: K229E

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108865
Gene: ENSMUSG00000005362
AA Change: K229E

DomainStartEndE-ValueType
low complexity region 24 40 N/A INTRINSIC
LON 83 320 2.33e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147087
Predicted Effect probably benign
Transcript: ENSMUST00000151484
AA Change: K216E

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000144723
Gene: ENSMUSG00000005362
AA Change: K216E

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
LON 70 253 3.1e-9 SMART
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.4%
  • 10x: 90.8%
  • 20x: 69.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein with a Lon protease domain, a "regulators of G protein-signaling" (RGS)-like domain and a leucine zipper. It has been proposed to regulate the assembly and surface expression of large-conductance calcium-activated potassium channels in brain and to bind thalidomide. In humans mutation in this gene causes autosomal recessive nonsyndromic mental retardation. In mouse deficiency of this gene serves as a model to study the molecular mechanisms governing learning and memory as they relate to intellectual disability. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired contextual conditioning behavior. Mice homozygous for another knock-out allele exhibit resistance to diet-induced obesity, liver steatosis, glucose intolerance and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T G 7: 12,512,580 M1R probably null Het
5031439G07Rik G T 15: 84,953,144 P280T probably damaging Het
Abca2 C T 2: 25,441,296 S1267L probably damaging Het
Acsl3 A T 1: 78,706,409 R719S probably benign Het
Adam1a A T 5: 121,519,776 probably null Het
Aldh6a1 T C 12: 84,441,770 E89G possibly damaging Het
Ankrd36 A G 11: 5,575,752 Y238C probably damaging Het
Ankrd65 G A 4: 155,792,905 R291Q probably benign Het
Ano2 C T 6: 125,796,264 R287W probably damaging Het
Ap1ar A G 3: 127,812,566 I125T probably benign Het
Arid1b A G 17: 5,242,922 D705G probably damaging Het
Asb18 T A 1: 89,996,283 N86I probably damaging Het
Bicral A T 17: 46,824,593 S564T probably benign Het
Bpifa6 A G 2: 153,989,272 M253V probably benign Het
Braf T C 6: 39,665,083 D194G probably damaging Het
Brinp3 C A 1: 146,901,962 P716T probably benign Het
C7 T A 15: 5,012,149 Y425F probably damaging Het
Ccdc102a T C 8: 94,906,086 K421R probably benign Het
Cep89 G A 7: 35,420,963 probably null Het
Chgb A T 2: 132,792,800 M221L probably benign Het
Chst14 A G 2: 118,927,664 Y313C probably damaging Het
Ciita G A 16: 10,513,288 probably null Het
Clec12b A T 6: 129,380,640 I85N probably damaging Het
Clec2e G T 6: 129,093,496 Y187* probably null Het
Ctdspl2 A T 2: 121,981,281 Q201L probably benign Het
Cyp2c55 T A 19: 39,011,081 V77E probably damaging Het
Cyp2c69 A C 19: 39,849,395 D414E probably damaging Het
Dlg1 A G 16: 31,842,822 probably null Het
Dnah5 C A 15: 28,230,463 S169* probably null Het
Dock4 C A 12: 40,755,810 T927K probably benign Het
Esrp2 T G 8: 106,133,821 D259A probably damaging Het
Fam169a A G 13: 97,118,530 K418R probably benign Het
Fancm A T 12: 65,099,293 I597F probably damaging Het
Fat1 G A 8: 45,010,545 V1375M probably damaging Het
Fbxw10 A T 11: 62,862,638 D486V probably damaging Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Foxp1 T A 6: 98,978,220 H195L possibly damaging Het
Gfra1 T A 19: 58,451,975 I138L probably benign Het
Gm12185 T C 11: 48,915,674 D230G possibly damaging Het
Gpd2 A C 2: 57,355,774 T439P probably damaging Het
Gpm6a A T 8: 55,037,350 K20N probably damaging Het
Hc A T 2: 34,983,807 Y158* probably null Het
Hectd4 A T 5: 121,349,172 D3410V possibly damaging Het
Il17b G A 18: 61,690,412 probably null Het
Irx4 G T 13: 73,265,576 R55L possibly damaging Het
Lama3 T C 18: 12,441,107 V582A probably benign Het
Ldhd G T 8: 111,627,293 A425E possibly damaging Het
Lrp1b C T 2: 40,927,829 probably null Het
Lrp5 T C 19: 3,620,191 T638A possibly damaging Het
Lrrk1 A C 7: 66,259,974 F1996C probably damaging Het
Ly6h G A 15: 75,566,137 S21L probably benign Het
Mctp1 T C 13: 76,825,273 V431A probably benign Het
Metap2 C T 10: 93,871,483 probably null Het
Mfsd2b T A 12: 4,870,536 K94* probably null Het
Micall2 A G 5: 139,719,342 L79P probably damaging Het
Mucl2 T C 15: 103,897,407 T95A possibly damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Myo5b G T 18: 74,740,503 V1467L probably damaging Het
Nfic G T 10: 81,420,580 D105E probably damaging Het
Nrd1 T A 4: 109,016,668 F227Y probably benign Het
Nrp2 A T 1: 62,738,299 I88F probably damaging Het
Nup160 A T 2: 90,700,543 H515L probably benign Het
Nup205 G A 6: 35,225,982 probably null Het
Oas1g G A 5: 120,882,006 T179I probably benign Het
Ogfr A T 2: 180,594,750 E376V probably damaging Het
Olfr1212 T G 2: 88,959,043 Y192* probably null Het
Olfr1241 A T 2: 89,482,511 V208D possibly damaging Het
Olfr166 T G 16: 19,487,628 S263R probably benign Het
Olfr478 C T 7: 108,032,388 probably null Het
Olfr646 G T 7: 104,106,689 V137F possibly damaging Het
Pard3b T C 1: 62,345,029 V851A probably benign Het
Pcdhb16 A T 18: 37,478,089 Y34F probably damaging Het
Pikfyve T C 1: 65,251,666 Y1215H probably damaging Het
Pkhd1 A T 1: 20,523,341 V1516E probably damaging Het
Ptprg A T 14: 12,190,767 I818F probably benign Het
Ralgapb A G 2: 158,462,253 E644G possibly damaging Het
Rbm45 A G 2: 76,372,115 I127M probably damaging Het
Rtp2 T C 16: 23,927,470 Y157C probably damaging Het
Sf3b3 A T 8: 110,837,374 Y329N probably damaging Het
Sfxn1 A G 13: 54,085,627 probably null Het
Shkbp1 A T 7: 27,345,326 C447S probably damaging Het
Sipa1l3 A G 7: 29,322,260 S689P possibly damaging Het
Slc7a8 A G 14: 54,733,199 S332P probably damaging Het
Slit1 C A 19: 41,608,384 C1092F probably damaging Het
Stard9 A G 2: 120,703,197 I619V possibly damaging Het
Sycp3 T C 10: 88,469,592 V185A possibly damaging Het
Taar9 A T 10: 24,109,484 N17K possibly damaging Het
Tbkbp1 T C 11: 97,148,988 E102G probably damaging Het
Tex44 A G 1: 86,427,112 N248D probably benign Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Tnpo1 C T 13: 98,850,157 V781I probably benign Het
Tonsl C T 15: 76,636,561 probably null Het
Ttc6 A G 12: 57,674,677 K984R possibly damaging Het
Usp34 A G 11: 23,441,171 E2263G probably damaging Het
Usp8 A G 2: 126,754,927 K875E probably damaging Het
Vmn1r223 A G 13: 23,249,868 I211V possibly damaging Het
Vmn2r81 G A 10: 79,293,662 V796I probably damaging Het
Wdr90 A T 17: 25,854,053 V856D probably damaging Het
Wnk2 T A 13: 49,082,095 T615S probably damaging Het
Other mutations in Crbn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02268:Crbn APN 6 106795043 missense possibly damaging 0.78
PIT4810001:Crbn UTSW 6 106784479 nonsense probably null
R0457:Crbn UTSW 6 106781057 missense probably benign 0.06
R1468:Crbn UTSW 6 106790843 missense probably benign 0.07
R1672:Crbn UTSW 6 106795925 missense probably damaging 1.00
R1710:Crbn UTSW 6 106790945 missense possibly damaging 0.90
R2255:Crbn UTSW 6 106795198 critical splice acceptor site probably null
R2427:Crbn UTSW 6 106783472 missense probably damaging 1.00
R3160:Crbn UTSW 6 106790866 missense probably benign 0.00
R3162:Crbn UTSW 6 106790866 missense probably benign 0.00
R3765:Crbn UTSW 6 106795026 missense possibly damaging 0.64
R3766:Crbn UTSW 6 106795026 missense possibly damaging 0.64
R4674:Crbn UTSW 6 106790971 missense possibly damaging 0.95
R4703:Crbn UTSW 6 106782922 missense possibly damaging 0.66
R5089:Crbn UTSW 6 106781718 missense possibly damaging 0.76
R5436:Crbn UTSW 6 106795900 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTCCTATGGAAACTAAAACCCACAG -3'
(R):5'- TTTAGAATCCAGCAAGCTAAAGTGCAGA -3'

Sequencing Primer
(F):5'- ACTGTGTAACATTTTACCACTACTG -3'
(R):5'- GCTAAAGTGCAGATTTTGCCAG -3'
Posted On2014-03-28