Incidental Mutation 'R1469:Tnnt2'
ID164734
Institutional Source Beutler Lab
Gene Symbol Tnnt2
Ensembl Gene ENSMUSG00000026414
Gene Nametroponin T2, cardiac
SynonymscTnT, Tnt, cardiac TnT
MMRRC Submission 039522-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1469 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location135836354-135852260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135852055 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 297 (T297A)
Ref Sequence ENSEMBL: ENSMUSP00000107716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027671] [ENSMUST00000112085] [ENSMUST00000112086] [ENSMUST00000112087] [ENSMUST00000178204] [ENSMUST00000178854] [ENSMUST00000179863] [ENSMUST00000188028] [ENSMUST00000189355] [ENSMUST00000189732] [ENSMUST00000189826] [ENSMUST00000190451]
Predicted Effect probably benign
Transcript: ENSMUST00000027671
AA Change: T287A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027671
Gene: ENSMUSG00000026414
AA Change: T287A

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
Pfam:Troponin 96 234 1e-33 PFAM
Pfam:Troponin 226 289 1.2e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112085
AA Change: T291A

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107715
Gene: ENSMUSG00000026414
AA Change: T291A

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
low complexity region 20 54 N/A INTRINSIC
Pfam:Troponin 100 238 2.4e-33 PFAM
Pfam:Troponin 230 293 2.7e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112086
AA Change: T297A

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107716
Gene: ENSMUSG00000026414
AA Change: T297A

DomainStartEndE-ValueType
low complexity region 3 58 N/A INTRINSIC
Pfam:Troponin 106 244 2.5e-33 PFAM
Pfam:Troponin 236 299 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112087
AA Change: T297A

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107717
Gene: ENSMUSG00000026414
AA Change: T297A

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
Pfam:Troponin 106 250 1.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178204
AA Change: T298A

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000137579
Gene: ENSMUSG00000026414
AA Change: T298A

DomainStartEndE-ValueType
coiled coil region 1 38 N/A INTRINSIC
Pfam:Troponin 110 245 3.8e-34 PFAM
Pfam:Troponin 238 300 4.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178854
AA Change: T291A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000136265
Gene: ENSMUSG00000026414
AA Change: T291A

DomainStartEndE-ValueType
coiled coil region 1 35 N/A INTRINSIC
Pfam:Troponin 100 244 1.7e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179863
AA Change: T298A

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000137093
Gene: ENSMUSG00000026414
AA Change: T298A

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
Pfam:Troponin 110 251 3e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000188028
AA Change: T298A

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140941
Gene: ENSMUSG00000026414
AA Change: T298A

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
Pfam:Troponin 110 251 3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188098
Predicted Effect probably benign
Transcript: ENSMUST00000189355
AA Change: T287A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000139919
Gene: ENSMUSG00000026414
AA Change: T287A

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
Pfam:Troponin 96 240 1.6e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189732
AA Change: T291A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000139669
Gene: ENSMUSG00000026414
AA Change: T291A

DomainStartEndE-ValueType
coiled coil region 1 35 N/A INTRINSIC
Pfam:Troponin 100 244 1.7e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189826
SMART Domains Protein: ENSMUSP00000140807
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
Pfam:Troponin 110 201 1.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190451
SMART Domains Protein: ENSMUSP00000140282
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
PDB:2Z5H|T 85 114 3e-7 PDB
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 95.3%
  • 10x: 69.3%
  • 20x: 30.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the tropomyosin-binding subunit of the troponin complex, which is located on the thin filament of striated muscles and regulates muscle contraction in response to alterations in intracellular calcium ion concentration. Mutations in this gene have been associated with familial hypertrophic cardiomyopathy as well as with dilated cardiomyopathy. Transcripts for this gene undergo alternative splicing that results in many tissue-specific isoforms, however, the full-length nature of some of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during and prior to organogenesis and abnormal heart development. Mice homozygous for an allele that lacks the lysine residue at position 210 exhibit dilated cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,891,679 V261E probably damaging Het
Abca15 A G 7: 120,382,497 E1058G probably benign Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Actn4 A G 7: 28,905,328 V348A probably benign Het
Agtr1b A T 3: 20,315,500 L314H probably damaging Het
Ankrd55 T C 13: 112,367,926 M402T probably benign Het
Asap2 A G 12: 21,213,179 Q265R probably benign Het
Atp2b4 G A 1: 133,706,939 R1124C probably damaging Het
Atp2c1 A T 9: 105,435,152 C353* probably null Het
Atp8b5 T A 4: 43,291,733 probably null Het
Baz1b T A 5: 135,217,979 Y761N probably damaging Het
Bend6 A G 1: 33,864,743 V38A probably benign Het
Camk1g T C 1: 193,362,091 E5G possibly damaging Het
Ccdc14 T A 16: 34,706,782 H352Q probably damaging Het
Cdh2 A G 18: 16,624,267 V641A possibly damaging Het
Celsr2 C A 3: 108,414,108 D463Y probably damaging Het
Cfap43 A G 19: 47,896,875 Y434H probably damaging Het
Cnih2 T C 19: 5,093,702 Y142C probably damaging Het
Coa5 T A 1: 37,420,600 R71* probably null Het
Csmd3 A T 15: 47,669,202 Y2532* probably null Het
Cytl1 A T 5: 37,735,647 M34L probably benign Het
Dctn1 T A 6: 83,192,889 I590N probably damaging Het
Dhx57 T C 17: 80,254,418 H889R probably damaging Het
Dock10 A G 1: 80,512,558 I1948T probably benign Het
Dock3 A T 9: 106,955,709 N1034K probably benign Het
Dzip1l G A 9: 99,659,776 probably null Het
Eif4g1 T A 16: 20,680,008 V439E possibly damaging Het
Eml5 T C 12: 98,858,823 I712V probably benign Het
Epha3 C T 16: 63,653,494 G300D probably damaging Het
Erbb4 A C 1: 68,560,682 S79A probably damaging Het
Fam189a2 G A 19: 23,973,606 T537I probably benign Het
Gclc T C 9: 77,781,137 V205A probably benign Het
Gdpd4 A G 7: 97,974,466 probably null Het
Gm11564 C T 11: 99,815,232 C124Y unknown Het
Gm16494 T C 17: 47,016,844 E38G probably damaging Het
Gtf2h1 T C 7: 46,805,125 probably null Het
Gtsf2 G T 15: 103,441,217 R68S probably benign Het
Heatr5b T C 17: 78,808,384 Q881R probably damaging Het
Hmox1 C A 8: 75,098,835 L236I probably benign Het
Ighv8-12 T C 12: 115,648,343 I7V probably benign Het
Izumo1 T C 7: 45,623,013 S73P probably damaging Het
Kif1bp A T 10: 62,559,450 F471Y probably damaging Het
Knl1 A G 2: 119,071,346 N1176S possibly damaging Het
Mecom A T 3: 29,980,048 L493Q probably damaging Het
Mprip T C 11: 59,759,190 V1240A probably damaging Het
Mrpl3 T C 9: 105,077,002 S302P probably damaging Het
Mycbp2 T C 14: 103,188,520 T2390A probably damaging Het
Myo1c T C 11: 75,669,961 S766P probably damaging Het
Myo9b A G 8: 71,291,036 Q247R probably damaging Het
Nav3 G A 10: 109,760,508 T1423I probably damaging Het
Nefh A T 11: 4,940,066 I851N probably benign Het
Nup98 T C 7: 102,138,801 T1004A probably benign Het
Olfr175-ps1 G A 16: 58,824,610 T33I probably benign Het
Olfr23 T C 11: 73,940,557 F104L probably benign Het
Olfr381 G A 11: 73,486,323 S167L possibly damaging Het
Olfr502 T C 7: 108,523,204 T249A probably benign Het
Osgin1 G T 8: 119,445,385 R306L possibly damaging Het
Otof A G 5: 30,380,227 L1246P probably benign Het
Pde8a T A 7: 81,302,271 N273K probably damaging Het
Phf14 T A 6: 11,933,727 M196K possibly damaging Het
Pkd1l3 T C 8: 109,646,953 S1374P possibly damaging Het
Pkhd1l1 T C 15: 44,536,886 V2142A probably benign Het
Plb1 A G 5: 32,354,826 E1318G possibly damaging Het
Plekhh2 A G 17: 84,575,771 I756V probably benign Het
Primpol A G 8: 46,593,637 V208A probably benign Het
Ptch2 C A 4: 117,108,465 A389E probably benign Het
Pzp A G 6: 128,512,356 Y431H probably benign Het
Rnf43 G A 11: 87,731,407 G445R probably damaging Het
Scn5a A T 9: 119,533,661 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Shisa9 T A 16: 11,985,071 M164K probably damaging Het
Skint1 A G 4: 112,025,511 I251V probably benign Het
Slc16a14 C T 1: 84,929,461 D31N probably damaging Het
Slc22a13 T C 9: 119,193,295 S548G possibly damaging Het
Slc4a9 T C 18: 36,531,101 F316L probably benign Het
Smchd1 C T 17: 71,349,730 R1914H probably damaging Het
Snx16 C T 3: 10,434,371 D200N probably damaging Het
Spock3 A G 8: 62,951,900 D34G probably damaging Het
Sspo T C 6: 48,490,982 C4154R probably damaging Het
Sytl3 C T 17: 6,687,324 A131V probably benign Het
Tacc1 T A 8: 25,182,255 D319V probably benign Het
Tead1 A T 7: 112,876,184 K234I probably damaging Het
Tgfbrap1 C T 1: 43,075,458 V161I probably benign Het
Tnfaip3 A G 10: 19,008,269 V121A probably damaging Het
Trappc11 G A 8: 47,503,965 L809F probably damaging Het
Ttn T C 2: 76,771,525 I18598V probably benign Het
Ugt1a10 G A 1: 88,216,254 A199T probably damaging Het
Unc5a A G 13: 54,996,419 N186D probably damaging Het
Uqcrfs1 C A 13: 30,540,801 G252V probably damaging Het
Vmn2r115 T C 17: 23,346,018 I293T probably damaging Het
Vmn2r9 T C 5: 108,843,828 T556A probably benign Het
Ythdc2 T A 18: 44,864,462 Y1029N probably benign Het
Zfp451 T A 1: 33,769,813 K989M possibly damaging Het
Zfpm1 C T 8: 122,335,846 T548M probably damaging Het
Other mutations in Tnnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Tnnt2 APN 1 135851702 missense probably damaging 1.00
IGL00885:Tnnt2 APN 1 135846764 splice site probably benign
IGL02223:Tnnt2 APN 1 135842015 intron probably benign
IGL03094:Tnnt2 APN 1 135849462 critical splice donor site probably null
R0827:Tnnt2 UTSW 1 135843796 intron probably benign
R1469:Tnnt2 UTSW 1 135852055 missense possibly damaging 0.83
R1478:Tnnt2 UTSW 1 135848026 missense probably benign 0.40
R1728:Tnnt2 UTSW 1 135845506 intron probably benign
R1729:Tnnt2 UTSW 1 135845506 intron probably benign
R1730:Tnnt2 UTSW 1 135845506 intron probably benign
R1739:Tnnt2 UTSW 1 135845506 intron probably benign
R1762:Tnnt2 UTSW 1 135845506 intron probably benign
R1783:Tnnt2 UTSW 1 135845506 intron probably benign
R1784:Tnnt2 UTSW 1 135845506 intron probably benign
R1785:Tnnt2 UTSW 1 135845506 intron probably benign
R1891:Tnnt2 UTSW 1 135840859 critical splice acceptor site probably null
R2049:Tnnt2 UTSW 1 135846761 splice site probably benign
R2104:Tnnt2 UTSW 1 135843809 intron probably benign
R2130:Tnnt2 UTSW 1 135846761 splice site probably benign
R2141:Tnnt2 UTSW 1 135846761 splice site probably benign
R2225:Tnnt2 UTSW 1 135843791 intron probably benign
R2227:Tnnt2 UTSW 1 135843791 intron probably benign
R2504:Tnnt2 UTSW 1 135852065 missense probably damaging 0.96
R4883:Tnnt2 UTSW 1 135847758 nonsense probably null
R5963:Tnnt2 UTSW 1 135843862 intron probably benign
R6082:Tnnt2 UTSW 1 135849434 missense probably benign 0.30
R6261:Tnnt2 UTSW 1 135850554 intron probably null
Predicted Primers PCR Primer
(F):5'- CCAAGGTGGTTGTTGTATTCCACCC -3'
(R):5'- GACTGGCATAAGTTCCTCCGAGTTG -3'

Sequencing Primer
(F):5'- CCCCTGCTCCAGAATGC -3'
(R):5'- GTTCCTCCGAGTTGGACAGATAC -3'
Posted On2014-03-28