Incidental Mutation 'R1469:Nup98'
ID164759
Institutional Source Beutler Lab
Gene Symbol Nup98
Ensembl Gene ENSMUSG00000063550
Gene Namenucleoporin 98
SynonymsNup96
MMRRC Submission 039522-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1469 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102119398-102210176 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102138801 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1004 (T1004A)
Ref Sequence ENSEMBL: ENSMUSP00000147486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070165] [ENSMUST00000210682] [ENSMUST00000211235]
Predicted Effect probably benign
Transcript: ENSMUST00000070165
AA Change: T1021A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068530
Gene: ENSMUSG00000063550
AA Change: T1021A

DomainStartEndE-ValueType
Pfam:Nucleoporin_FG 3 88 4.6e-4 PFAM
Pfam:Nucleoporin_FG 69 170 3.4e-6 PFAM
Pfam:Nucleoporin_FG 210 307 6.1e-5 PFAM
Pfam:Nucleoporin_FG 246 332 2.2e-7 PFAM
Pfam:Nucleoporin_FG 266 359 1.2e-7 PFAM
Pfam:Nucleoporin_FG 309 425 1.8e-2 PFAM
Pfam:Nucleoporin_FG 398 497 2.2e-2 PFAM
low complexity region 594 610 N/A INTRINSIC
low complexity region 673 684 N/A INTRINSIC
Pfam:Nucleoporin2 740 880 5.4e-45 PFAM
PDB:1KO6|D 881 925 1e-16 PDB
low complexity region 926 935 N/A INTRINSIC
low complexity region 1033 1042 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210682
AA Change: T1021A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211235
AA Change: T1004A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 95.3%
  • 10x: 69.3%
  • 20x: 30.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes (NPCs) regulate the transport of macromolecules between the nucleus and cytoplasm, and are composed of many polypeptide subunits, many of which belong to the nucleoporin family. This gene belongs to the nucleoporin gene family and encodes a 186 kDa precursor protein that undergoes autoproteolytic cleavage to generate a 98 kDa nucleoporin and 96 kDa nucleoporin. The 98 kDa nucleoporin contains a Gly-Leu-Phe-Gly (GLGF) repeat domain and participates in many cellular processes, including nuclear import, nuclear export, mitotic progression, and regulation of gene expression. The 96 kDa nucleoporin is a scaffold component of the NPC. Proteolytic cleavage is important for targeting of the proteins to the NPC. Translocations between this gene and many other partner genes have been observed in different leukemias. Rearrangements typically result in chimeras with the N-terminal GLGF domain of this gene to the C-terminus of the partner gene. Alternative splicing results in multiple transcript variants encoding different isoforms, at least two of which are proteolytically processed. Some variants lack the region that encodes the 96 kDa nucleoporin. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for a null allele die in utero with a severe growth delay and improper gastrulation and nuclear pore complex assembly/function. Heterozygotes for another null allele show impaired IFN-mediated responses, reduced T and B cell subsets in lymphoid organs and altered T and B cell functions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,891,679 V261E probably damaging Het
Abca15 A G 7: 120,382,497 E1058G probably benign Het
Abcb5 T G 12: 118,867,946 I1224L possibly damaging Het
Actn4 A G 7: 28,905,328 V348A probably benign Het
Agtr1b A T 3: 20,315,500 L314H probably damaging Het
Ankrd55 T C 13: 112,367,926 M402T probably benign Het
Asap2 A G 12: 21,213,179 Q265R probably benign Het
Atp2b4 G A 1: 133,706,939 R1124C probably damaging Het
Atp2c1 A T 9: 105,435,152 C353* probably null Het
Atp8b5 T A 4: 43,291,733 probably null Het
Baz1b T A 5: 135,217,979 Y761N probably damaging Het
Bend6 A G 1: 33,864,743 V38A probably benign Het
Camk1g T C 1: 193,362,091 E5G possibly damaging Het
Ccdc14 T A 16: 34,706,782 H352Q probably damaging Het
Cdh2 A G 18: 16,624,267 V641A possibly damaging Het
Celsr2 C A 3: 108,414,108 D463Y probably damaging Het
Cfap43 A G 19: 47,896,875 Y434H probably damaging Het
Cnih2 T C 19: 5,093,702 Y142C probably damaging Het
Coa5 T A 1: 37,420,600 R71* probably null Het
Csmd3 A T 15: 47,669,202 Y2532* probably null Het
Cytl1 A T 5: 37,735,647 M34L probably benign Het
Dctn1 T A 6: 83,192,889 I590N probably damaging Het
Dhx57 T C 17: 80,254,418 H889R probably damaging Het
Dock10 A G 1: 80,512,558 I1948T probably benign Het
Dock3 A T 9: 106,955,709 N1034K probably benign Het
Dzip1l G A 9: 99,659,776 probably null Het
Eif4g1 T A 16: 20,680,008 V439E possibly damaging Het
Eml5 T C 12: 98,858,823 I712V probably benign Het
Epha3 C T 16: 63,653,494 G300D probably damaging Het
Erbb4 A C 1: 68,560,682 S79A probably damaging Het
Fam189a2 G A 19: 23,973,606 T537I probably benign Het
Gclc T C 9: 77,781,137 V205A probably benign Het
Gdpd4 A G 7: 97,974,466 probably null Het
Gm11564 C T 11: 99,815,232 C124Y unknown Het
Gm16494 T C 17: 47,016,844 E38G probably damaging Het
Gtf2h1 T C 7: 46,805,125 probably null Het
Gtsf2 G T 15: 103,441,217 R68S probably benign Het
Heatr5b T C 17: 78,808,384 Q881R probably damaging Het
Hmox1 C A 8: 75,098,835 L236I probably benign Het
Ighv8-12 T C 12: 115,648,343 I7V probably benign Het
Izumo1 T C 7: 45,623,013 S73P probably damaging Het
Kif1bp A T 10: 62,559,450 F471Y probably damaging Het
Knl1 A G 2: 119,071,346 N1176S possibly damaging Het
Mecom A T 3: 29,980,048 L493Q probably damaging Het
Mprip T C 11: 59,759,190 V1240A probably damaging Het
Mrpl3 T C 9: 105,077,002 S302P probably damaging Het
Mycbp2 T C 14: 103,188,520 T2390A probably damaging Het
Myo1c T C 11: 75,669,961 S766P probably damaging Het
Myo9b A G 8: 71,291,036 Q247R probably damaging Het
Nav3 G A 10: 109,760,508 T1423I probably damaging Het
Nefh A T 11: 4,940,066 I851N probably benign Het
Olfr175-ps1 G A 16: 58,824,610 T33I probably benign Het
Olfr23 T C 11: 73,940,557 F104L probably benign Het
Olfr381 G A 11: 73,486,323 S167L possibly damaging Het
Olfr502 T C 7: 108,523,204 T249A probably benign Het
Osgin1 G T 8: 119,445,385 R306L possibly damaging Het
Otof A G 5: 30,380,227 L1246P probably benign Het
Pde8a T A 7: 81,302,271 N273K probably damaging Het
Phf14 T A 6: 11,933,727 M196K possibly damaging Het
Pkd1l3 T C 8: 109,646,953 S1374P possibly damaging Het
Pkhd1l1 T C 15: 44,536,886 V2142A probably benign Het
Plb1 A G 5: 32,354,826 E1318G possibly damaging Het
Plekhh2 A G 17: 84,575,771 I756V probably benign Het
Primpol A G 8: 46,593,637 V208A probably benign Het
Ptch2 C A 4: 117,108,465 A389E probably benign Het
Pzp A G 6: 128,512,356 Y431H probably benign Het
Rnf43 G A 11: 87,731,407 G445R probably damaging Het
Scn5a A T 9: 119,533,661 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Shisa9 T A 16: 11,985,071 M164K probably damaging Het
Skint1 A G 4: 112,025,511 I251V probably benign Het
Slc16a14 C T 1: 84,929,461 D31N probably damaging Het
Slc22a13 T C 9: 119,193,295 S548G possibly damaging Het
Slc4a9 T C 18: 36,531,101 F316L probably benign Het
Smchd1 C T 17: 71,349,730 R1914H probably damaging Het
Snx16 C T 3: 10,434,371 D200N probably damaging Het
Spock3 A G 8: 62,951,900 D34G probably damaging Het
Sspo T C 6: 48,490,982 C4154R probably damaging Het
Sytl3 C T 17: 6,687,324 A131V probably benign Het
Tacc1 T A 8: 25,182,255 D319V probably benign Het
Tead1 A T 7: 112,876,184 K234I probably damaging Het
Tgfbrap1 C T 1: 43,075,458 V161I probably benign Het
Tnfaip3 A G 10: 19,008,269 V121A probably damaging Het
Tnnt2 A G 1: 135,852,055 T297A possibly damaging Het
Trappc11 G A 8: 47,503,965 L809F probably damaging Het
Ttn T C 2: 76,771,525 I18598V probably benign Het
Ugt1a10 G A 1: 88,216,254 A199T probably damaging Het
Unc5a A G 13: 54,996,419 N186D probably damaging Het
Uqcrfs1 C A 13: 30,540,801 G252V probably damaging Het
Vmn2r115 T C 17: 23,346,018 I293T probably damaging Het
Vmn2r9 T C 5: 108,843,828 T556A probably benign Het
Ythdc2 T A 18: 44,864,462 Y1029N probably benign Het
Zfp451 T A 1: 33,769,813 K989M possibly damaging Het
Zfpm1 C T 8: 122,335,846 T548M probably damaging Het
Other mutations in Nup98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Nup98 APN 7 102194987 missense probably damaging 1.00
IGL00789:Nup98 APN 7 102153971 missense probably benign
IGL00798:Nup98 APN 7 102147204 missense probably damaging 1.00
IGL01562:Nup98 APN 7 102185918 missense probably damaging 0.99
IGL01942:Nup98 APN 7 102194711 missense probably damaging 1.00
IGL02109:Nup98 APN 7 102183486 missense probably benign 0.37
IGL02490:Nup98 APN 7 102152366 missense probably damaging 1.00
IGL03184:Nup98 APN 7 102183545 missense probably damaging 0.99
R0040:Nup98 UTSW 7 102192034 missense probably damaging 1.00
R0133:Nup98 UTSW 7 102139652 critical splice acceptor site probably null
R0309:Nup98 UTSW 7 102152428 missense probably null
R0471:Nup98 UTSW 7 102138797 missense probably benign 0.13
R0538:Nup98 UTSW 7 102186685 missense probably damaging 1.00
R0650:Nup98 UTSW 7 102152453 missense probably damaging 1.00
R0730:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R0881:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R0900:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R1120:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R1159:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R1469:Nup98 UTSW 7 102138801 missense probably benign 0.00
R1470:Nup98 UTSW 7 102147306 missense probably damaging 0.98
R1470:Nup98 UTSW 7 102147306 missense probably damaging 0.98
R1545:Nup98 UTSW 7 102134880 missense possibly damaging 0.77
R1775:Nup98 UTSW 7 102134937 missense probably benign 0.03
R1889:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R2080:Nup98 UTSW 7 102180424 missense probably damaging 0.96
R3423:Nup98 UTSW 7 102184877 missense probably benign 0.03
R4361:Nup98 UTSW 7 102145714 missense probably damaging 1.00
R4678:Nup98 UTSW 7 102184831 missense probably damaging 1.00
R4864:Nup98 UTSW 7 102153196 missense possibly damaging 0.94
R4910:Nup98 UTSW 7 102195800 missense unknown
R4924:Nup98 UTSW 7 102134978 missense probably damaging 1.00
R5068:Nup98 UTSW 7 102145655 missense probably benign 0.00
R5069:Nup98 UTSW 7 102145655 missense probably benign 0.00
R5233:Nup98 UTSW 7 102195822 missense unknown
R5779:Nup98 UTSW 7 102152361 missense probably benign
R5922:Nup98 UTSW 7 102154017 missense probably damaging 1.00
R6010:Nup98 UTSW 7 102180429 missense probably damaging 1.00
R6039:Nup98 UTSW 7 102134795 missense probably benign
R6039:Nup98 UTSW 7 102134795 missense probably benign
R6343:Nup98 UTSW 7 102194750 missense possibly damaging 0.90
R6364:Nup98 UTSW 7 102176315 missense probably damaging 1.00
R6462:Nup98 UTSW 7 102195016 missense probably benign 0.03
R6577:Nup98 UTSW 7 102128846 intron probably null
R6900:Nup98 UTSW 7 102185962 missense probably damaging 1.00
T0970:Nup98 UTSW 7 102186752 unclassified probably benign
X0054:Nup98 UTSW 7 102147208 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTTCTGCTAAAGAGATCCATTCAGC -3'
(R):5'- CTCAGCAACGTTTGTAACTTTACTGCC -3'

Sequencing Primer
(F):5'- GAGATCCATTCAGCTTAGAAGAAAC -3'
(R):5'- ATACTTGTTCTGGGCACAGAC -3'
Posted On2014-03-28