Incidental Mutation 'R1208:Slc25a25'
ID 164813
Institutional Source Beutler Lab
Gene Symbol Slc25a25
Ensembl Gene ENSMUSG00000026819
Gene Name solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25
Synonyms 1110030N17Rik
MMRRC Submission 039277-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1208 (G1)
Quality Score 210
Status Not validated
Chromosome 2
Chromosomal Location 32304499-32341457 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32307437 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 309 (E309G)
Ref Sequence ENSEMBL: ENSMUSP00000108936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028160] [ENSMUST00000052119] [ENSMUST00000113307] [ENSMUST00000113308] [ENSMUST00000113310] [ENSMUST00000136361] [ENSMUST00000153886]
AlphaFold A2ASZ8
Predicted Effect probably benign
Transcript: ENSMUST00000028160
AA Change: E321G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000028160
Gene: ENSMUSG00000026819
AA Change: E321G

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
EFh 48 76 8.73e0 SMART
EFh 84 112 2.64e-1 SMART
EFh 115 143 1.36e0 SMART
Blast:EFh 151 191 1e-9 BLAST
Pfam:Mito_carr 227 320 1.7e-26 PFAM
Pfam:Mito_carr 321 413 6.4e-26 PFAM
Pfam:Mito_carr 418 512 9.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052119
AA Change: E308G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000060581
Gene: ENSMUSG00000026819
AA Change: E308G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EFh 71 99 4.53e0 SMART
EFh 102 130 1.36e0 SMART
Blast:EFh 138 178 2e-9 BLAST
Pfam:Mito_carr 214 307 1.2e-26 PFAM
Pfam:Mito_carr 308 400 2.5e-27 PFAM
Pfam:Mito_carr 405 500 4.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113307
AA Change: E276G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000108932
Gene: ENSMUSG00000026819
AA Change: E276G

DomainStartEndE-ValueType
EFh 51 79 9.51e0 SMART
EFh 82 110 1.36e0 SMART
EFh 118 146 8.82e1 SMART
Pfam:Mito_carr 182 275 1.1e-26 PFAM
Pfam:Mito_carr 276 368 2.2e-27 PFAM
Pfam:Mito_carr 373 468 4.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113308
AA Change: E296G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000108933
Gene: ENSMUSG00000026819
AA Change: E296G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EFh 71 99 4.53e0 SMART
EFh 102 130 1.36e0 SMART
EFh 138 166 8.82e1 SMART
Pfam:Mito_carr 202 295 1.1e-26 PFAM
Pfam:Mito_carr 296 388 2.4e-27 PFAM
Pfam:Mito_carr 393 488 4.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113310
AA Change: E309G

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108936
Gene: ENSMUSG00000026819
AA Change: E309G

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
EFh 48 76 8.73e0 SMART
EFh 84 112 2.64e-1 SMART
EFh 115 143 1.36e0 SMART
EFh 151 179 8.82e1 SMART
Pfam:Mito_carr 215 308 1.2e-26 PFAM
Pfam:Mito_carr 309 401 2.5e-27 PFAM
Pfam:Mito_carr 406 501 4.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127961
SMART Domains Protein: ENSMUSP00000121932
Gene: ENSMUSG00000026819

DomainStartEndE-ValueType
EFh 36 64 8.99e0 SMART
EFh 67 95 1.36e0 SMART
Blast:EFh 103 143 1e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128611
Predicted Effect probably benign
Transcript: ENSMUST00000136361
AA Change: E261G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000115617
Gene: ENSMUSG00000026819
AA Change: E261G

DomainStartEndE-ValueType
EFh 36 64 8.99e0 SMART
EFh 67 95 1.36e0 SMART
EFh 103 131 8.82e1 SMART
Pfam:Mito_carr 167 260 9.3e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153782
Predicted Effect probably benign
Transcript: ENSMUST00000153886
SMART Domains Protein: ENSMUSP00000141486
Gene: ENSMUSG00000026819

DomainStartEndE-ValueType
SCOP:d1exra_ 1 38 1e-4 SMART
Blast:EFh 15 43 2e-13 BLAST
Pfam:Mito_carr 79 112 1.1e-7 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of calcium-binding mitochondrial carriers, with a characteristic mitochondrial carrier domain at the C-terminus. These proteins are found in the inner membranes of mitochondria, and function as transport proteins. They shuttle metabolites, nucleotides and cofactors through the mitochondrial membrane and thereby connect and/or regulate cytoplasm and matrix functions. This protein may function as an ATP-Mg/Pi carrier that mediates the transport of Mg-ATP in exchange for phosphate, and likely responsible for the net uptake or efflux of adenine nucleotides into or from the mitochondria. Alternatively spliced transcript variants encoding different isoforms with a common C-terminus but variable N-termini have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced physical endurance and metabolic efficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik C A 7: 29,260,708 (GRCm39) noncoding transcript Het
Aadacl2fm3 C T 3: 59,772,715 (GRCm39) P73L probably benign Het
Asb14 T C 14: 26,622,375 (GRCm39) probably benign Het
Atp13a3 A T 16: 30,173,065 (GRCm39) C271S probably benign Het
Ccl25 T A 8: 4,407,631 (GRCm39) S199T possibly damaging Het
Cdh15 G C 8: 123,584,234 (GRCm39) E112Q probably damaging Het
Cep104 A T 4: 154,069,836 (GRCm39) D270V probably damaging Het
Dnah5 T A 15: 28,327,877 (GRCm39) Y2084N probably damaging Het
Eftud2 A G 11: 102,755,592 (GRCm39) V214A probably benign Het
Epb41l4b C T 4: 57,077,252 (GRCm39) probably null Het
Gys2 A G 6: 142,396,193 (GRCm39) probably null Het
Lig4 T C 8: 10,021,062 (GRCm39) E906G probably damaging Het
Mast3 G A 8: 71,240,916 (GRCm39) probably null Het
Mta2 G A 19: 8,928,381 (GRCm39) R560H probably damaging Het
Myom2 T C 8: 15,134,631 (GRCm39) L478P probably damaging Het
Neb A T 2: 52,193,912 (GRCm39) L673* probably null Het
Niban3 A T 8: 72,053,119 (GRCm39) T125S probably damaging Het
Or4c35 G A 2: 89,808,836 (GRCm39) C238Y probably damaging Het
Pdpk1 C A 17: 24,312,583 (GRCm39) probably null Het
Pphln1 T C 15: 93,357,610 (GRCm39) W162R probably damaging Het
Ppp1r13b A G 12: 111,811,339 (GRCm39) V183A probably damaging Het
Recql5 T C 11: 115,783,982 (GRCm39) K951E probably damaging Het
Rev1 T C 1: 38,098,199 (GRCm39) probably benign Het
Slc25a36 T C 9: 96,967,188 (GRCm39) probably benign Het
Sycp2 A T 2: 177,998,421 (GRCm39) I1033N possibly damaging Het
Tbpl2 A T 2: 23,984,783 (GRCm39) N120K probably benign Het
Unc5b A T 10: 60,602,771 (GRCm39) L876Q probably damaging Het
Usp9y T C Y: 1,356,282 (GRCm39) T1140A probably benign Homo
Vmn1r40 A G 6: 89,691,326 (GRCm39) I48V probably benign Het
Zbbx T C 3: 74,945,299 (GRCm39) I708V possibly damaging Het
Zfp318 AGAAGA AGAAGAGGAAGA 17: 46,723,446 (GRCm39) probably benign Het
Other mutations in Slc25a25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Slc25a25 APN 2 32,309,172 (GRCm39) missense probably benign 0.04
IGL01431:Slc25a25 APN 2 32,309,103 (GRCm39) missense probably damaging 1.00
IGL02211:Slc25a25 APN 2 32,307,452 (GRCm39) missense probably damaging 1.00
IGL02393:Slc25a25 APN 2 32,307,855 (GRCm39) missense probably benign 0.40
R0385:Slc25a25 UTSW 2 32,307,834 (GRCm39) missense probably damaging 0.99
R1208:Slc25a25 UTSW 2 32,307,437 (GRCm39) missense probably benign 0.11
R1611:Slc25a25 UTSW 2 32,310,391 (GRCm39) missense probably damaging 1.00
R1960:Slc25a25 UTSW 2 32,310,663 (GRCm39) splice site probably null
R2405:Slc25a25 UTSW 2 32,307,731 (GRCm39) splice site probably null
R3749:Slc25a25 UTSW 2 32,310,392 (GRCm39) missense probably benign 0.21
R4446:Slc25a25 UTSW 2 32,320,621 (GRCm39) missense probably benign 0.00
R4815:Slc25a25 UTSW 2 32,310,422 (GRCm39) missense probably damaging 1.00
R5245:Slc25a25 UTSW 2 32,311,340 (GRCm39) nonsense probably null
R6884:Slc25a25 UTSW 2 32,310,674 (GRCm39) missense probably benign 0.34
R7144:Slc25a25 UTSW 2 32,309,178 (GRCm39) missense probably damaging 1.00
R7210:Slc25a25 UTSW 2 32,310,408 (GRCm39) missense possibly damaging 0.89
R7255:Slc25a25 UTSW 2 32,311,384 (GRCm39) missense possibly damaging 0.60
R7667:Slc25a25 UTSW 2 32,341,221 (GRCm39) missense probably benign 0.00
R7893:Slc25a25 UTSW 2 32,341,177 (GRCm39) nonsense probably null
R8031:Slc25a25 UTSW 2 32,311,517 (GRCm39) missense probably damaging 0.97
R8550:Slc25a25 UTSW 2 32,306,205 (GRCm39) missense probably damaging 1.00
R9076:Slc25a25 UTSW 2 32,309,175 (GRCm39) missense probably damaging 1.00
R9255:Slc25a25 UTSW 2 32,310,391 (GRCm39) missense probably damaging 1.00
X0021:Slc25a25 UTSW 2 32,311,526 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTAGCCAAGATCCTCCTGGCAC -3'
(R):5'- CTCCTTCCATTTGGGGACAGCATAG -3'

Sequencing Primer
(F):5'- GCCATTCGGGTCTTCAGAAC -3'
(R):5'- TAGATAGCTTCACGGTCACAG -3'
Posted On 2014-03-28