Incidental Mutation 'R1208:Cep104'
ID 164820
Institutional Source Beutler Lab
Gene Symbol Cep104
Ensembl Gene ENSMUSG00000039523
Gene Name centrosomal protein 104
Synonyms BC046331
MMRRC Submission 039277-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.432) question?
Stock # R1208 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 154059651-154093189 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 154069836 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 270 (D270V)
Ref Sequence ENSEMBL: ENSMUSP00000040762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047497]
AlphaFold Q80V31
Predicted Effect probably damaging
Transcript: ENSMUST00000047497
AA Change: D270V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040762
Gene: ENSMUSG00000039523
AA Change: D270V

DomainStartEndE-ValueType
coiled coil region 222 249 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
low complexity region 307 320 N/A INTRINSIC
SCOP:d1gw5b_ 523 646 3e-5 SMART
coiled coil region 688 730 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155414
Predicted Effect probably benign
Transcript: ENSMUST00000183790
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein required for ciliogenesis and for ciliary tip structural integrity. The mammalian protein contains three amino-terminal hydrophobic domains, two glycosylation sites, four cysteine-rich motifs, and two regions with homology to the glutamate receptor ionotropic, NMDA 1 protein. During ciliogenesis, the encoded protein translocates from the distal tips of the centrioles to the tip of the elongating cilium. Knockdown of the protein in human retinal pigment cells results in severe defects in ciliogenesis with structural deformities at the ciliary tips. Allelic variants of this gene are associated with the autosomal-recessive disorder Joubert syndrome, which is characterized by a distinctive mid-hindbrain and cerebellar malformation, oculomotor apraxia, irregular breathing, developmental delay, and ataxia. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik C A 7: 29,260,708 (GRCm39) noncoding transcript Het
Aadacl2fm3 C T 3: 59,772,715 (GRCm39) P73L probably benign Het
Asb14 T C 14: 26,622,375 (GRCm39) probably benign Het
Atp13a3 A T 16: 30,173,065 (GRCm39) C271S probably benign Het
Ccl25 T A 8: 4,407,631 (GRCm39) S199T possibly damaging Het
Cdh15 G C 8: 123,584,234 (GRCm39) E112Q probably damaging Het
Dnah5 T A 15: 28,327,877 (GRCm39) Y2084N probably damaging Het
Eftud2 A G 11: 102,755,592 (GRCm39) V214A probably benign Het
Epb41l4b C T 4: 57,077,252 (GRCm39) probably null Het
Gys2 A G 6: 142,396,193 (GRCm39) probably null Het
Lig4 T C 8: 10,021,062 (GRCm39) E906G probably damaging Het
Mast3 G A 8: 71,240,916 (GRCm39) probably null Het
Mta2 G A 19: 8,928,381 (GRCm39) R560H probably damaging Het
Myom2 T C 8: 15,134,631 (GRCm39) L478P probably damaging Het
Neb A T 2: 52,193,912 (GRCm39) L673* probably null Het
Niban3 A T 8: 72,053,119 (GRCm39) T125S probably damaging Het
Or4c35 G A 2: 89,808,836 (GRCm39) C238Y probably damaging Het
Pdpk1 C A 17: 24,312,583 (GRCm39) probably null Het
Pphln1 T C 15: 93,357,610 (GRCm39) W162R probably damaging Het
Ppp1r13b A G 12: 111,811,339 (GRCm39) V183A probably damaging Het
Recql5 T C 11: 115,783,982 (GRCm39) K951E probably damaging Het
Rev1 T C 1: 38,098,199 (GRCm39) probably benign Het
Slc25a25 T C 2: 32,307,437 (GRCm39) E309G probably benign Het
Slc25a36 T C 9: 96,967,188 (GRCm39) probably benign Het
Sycp2 A T 2: 177,998,421 (GRCm39) I1033N possibly damaging Het
Tbpl2 A T 2: 23,984,783 (GRCm39) N120K probably benign Het
Unc5b A T 10: 60,602,771 (GRCm39) L876Q probably damaging Het
Usp9y T C Y: 1,356,282 (GRCm39) T1140A probably benign Homo
Vmn1r40 A G 6: 89,691,326 (GRCm39) I48V probably benign Het
Zbbx T C 3: 74,945,299 (GRCm39) I708V possibly damaging Het
Zfp318 AGAAGA AGAAGAGGAAGA 17: 46,723,446 (GRCm39) probably benign Het
Other mutations in Cep104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02755:Cep104 APN 4 154,081,416 (GRCm39) missense possibly damaging 0.93
IGL02884:Cep104 APN 4 154,074,319 (GRCm39) missense probably damaging 0.96
IGL02928:Cep104 APN 4 154,065,716 (GRCm39) missense probably benign 0.18
IGL03119:Cep104 APN 4 154,066,181 (GRCm39) missense probably damaging 1.00
R0409:Cep104 UTSW 4 154,067,510 (GRCm39) splice site probably benign
R0505:Cep104 UTSW 4 154,080,761 (GRCm39) missense probably benign 0.00
R0600:Cep104 UTSW 4 154,091,249 (GRCm39) missense possibly damaging 0.58
R1208:Cep104 UTSW 4 154,069,836 (GRCm39) missense probably damaging 1.00
R1221:Cep104 UTSW 4 154,072,902 (GRCm39) missense probably benign 0.00
R1338:Cep104 UTSW 4 154,078,965 (GRCm39) missense probably benign 0.01
R1528:Cep104 UTSW 4 154,078,965 (GRCm39) missense probably benign 0.01
R1648:Cep104 UTSW 4 154,063,553 (GRCm39) critical splice donor site probably null
R1831:Cep104 UTSW 4 154,087,003 (GRCm39) missense probably benign 0.30
R1832:Cep104 UTSW 4 154,087,003 (GRCm39) missense probably benign 0.30
R1911:Cep104 UTSW 4 154,091,255 (GRCm39) missense possibly damaging 0.74
R1914:Cep104 UTSW 4 154,074,296 (GRCm39) missense possibly damaging 0.79
R2516:Cep104 UTSW 4 154,073,603 (GRCm39) missense probably damaging 1.00
R2910:Cep104 UTSW 4 154,079,884 (GRCm39) splice site probably null
R2911:Cep104 UTSW 4 154,079,884 (GRCm39) splice site probably null
R3751:Cep104 UTSW 4 154,066,213 (GRCm39) missense probably damaging 1.00
R3828:Cep104 UTSW 4 154,069,400 (GRCm39) missense probably damaging 1.00
R3829:Cep104 UTSW 4 154,069,400 (GRCm39) missense probably damaging 1.00
R3830:Cep104 UTSW 4 154,069,400 (GRCm39) missense probably damaging 1.00
R4474:Cep104 UTSW 4 154,073,693 (GRCm39) missense possibly damaging 0.47
R4731:Cep104 UTSW 4 154,072,883 (GRCm39) missense probably damaging 1.00
R4732:Cep104 UTSW 4 154,072,883 (GRCm39) missense probably damaging 1.00
R4733:Cep104 UTSW 4 154,072,883 (GRCm39) missense probably damaging 1.00
R5306:Cep104 UTSW 4 154,090,699 (GRCm39) missense probably benign 0.02
R5449:Cep104 UTSW 4 154,069,762 (GRCm39) splice site probably null
R5567:Cep104 UTSW 4 154,086,734 (GRCm39) missense possibly damaging 0.64
R5761:Cep104 UTSW 4 154,065,681 (GRCm39) missense possibly damaging 0.63
R5980:Cep104 UTSW 4 154,072,930 (GRCm39) missense probably benign 0.00
R7003:Cep104 UTSW 4 154,078,018 (GRCm39) missense probably benign 0.00
R7179:Cep104 UTSW 4 154,077,324 (GRCm39) missense probably damaging 0.99
R7376:Cep104 UTSW 4 154,067,509 (GRCm39) splice site probably null
R8278:Cep104 UTSW 4 154,068,122 (GRCm39) missense possibly damaging 0.92
R8877:Cep104 UTSW 4 154,077,985 (GRCm39) missense probably damaging 0.98
R9035:Cep104 UTSW 4 154,063,462 (GRCm39) missense probably benign 0.39
R9060:Cep104 UTSW 4 154,074,281 (GRCm39) missense probably damaging 0.98
R9165:Cep104 UTSW 4 154,078,971 (GRCm39) critical splice donor site probably null
X0026:Cep104 UTSW 4 154,071,342 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTACAGCTTCTGAGCACATACCC -3'
(R):5'- AGAAGATTGCATCACAGCAGAGACC -3'

Sequencing Primer
(F):5'- ACCCCTGAAGGTTCCTGAAG -3'
(R):5'- CAGAGACCTGCTGATTGTTCAAG -3'
Posted On 2014-03-28