Mutagenetix > Incidental Mutation

Incidental Mutation 'R1208:Mast3'

164827

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

039277-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1208 (G1)

Quality Score

126

Status

Not validated

Chromosome

Chromosomal Location

71230761-71257681 bp(-) (GRCm39)

Type of Mutation

splice site (626 bp from exon)

DNA Base Change (assembly)

G to A at 71240916 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148351 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212757] [ENSMUST00000212875] [ENSMUST00000212673]

AlphaFold

Q3U214

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166004
AA Change: A227V

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: A227V

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211841

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211948
AA Change: A211V

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

probably null
Transcript: ENSMUST00000212001

Predicted Effect

probably null
Transcript: ENSMUST00000212038

Predicted Effect

probably benign
Transcript: ENSMUST00000212140

Predicted Effect

probably null
Transcript: ENSMUST00000212551

Predicted Effect

probably null
Transcript: ENSMUST00000212757

Predicted Effect

probably null
Transcript: ENSMUST00000212875

Predicted Effect

probably null
Transcript: ENSMUST00000212673

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.9%
20x: 91.3%

Validation Efficiency

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	C	A	7: 29,260,708 (GRCm39)		noncoding transcript	Het
Aadacl2fm3	C	T	3: 59,772,715 (GRCm39)	P73L	probably benign	Het
Asb14	T	C	14: 26,622,375 (GRCm39)		probably benign	Het
Atp13a3	A	T	16: 30,173,065 (GRCm39)	C271S	probably benign	Het
Ccl25	T	A	8: 4,407,631 (GRCm39)	S199T	possibly damaging	Het
Cdh15	G	C	8: 123,584,234 (GRCm39)	E112Q	probably damaging	Het
Cep104	A	T	4: 154,069,836 (GRCm39)	D270V	probably damaging	Het
Dnah5	T	A	15: 28,327,877 (GRCm39)	Y2084N	probably damaging	Het
Eftud2	A	G	11: 102,755,592 (GRCm39)	V214A	probably benign	Het
Epb41l4b	C	T	4: 57,077,252 (GRCm39)		probably null	Het
Gys2	A	G	6: 142,396,193 (GRCm39)		probably null	Het
Lig4	T	C	8: 10,021,062 (GRCm39)	E906G	probably damaging	Het
Mta2	G	A	19: 8,928,381 (GRCm39)	R560H	probably damaging	Het
Myom2	T	C	8: 15,134,631 (GRCm39)	L478P	probably damaging	Het
Neb	A	T	2: 52,193,912 (GRCm39)	L673*	probably null	Het
Niban3	A	T	8: 72,053,119 (GRCm39)	T125S	probably damaging	Het
Or4c35	G	A	2: 89,808,836 (GRCm39)	C238Y	probably damaging	Het
Pdpk1	C	A	17: 24,312,583 (GRCm39)		probably null	Het
Pphln1	T	C	15: 93,357,610 (GRCm39)	W162R	probably damaging	Het
Ppp1r13b	A	G	12: 111,811,339 (GRCm39)	V183A	probably damaging	Het
Recql5	T	C	11: 115,783,982 (GRCm39)	K951E	probably damaging	Het
Rev1	T	C	1: 38,098,199 (GRCm39)		probably benign	Het
Slc25a25	T	C	2: 32,307,437 (GRCm39)	E309G	probably benign	Het
Slc25a36	T	C	9: 96,967,188 (GRCm39)		probably benign	Het
Sycp2	A	T	2: 177,998,421 (GRCm39)	I1033N	possibly damaging	Het
Tbpl2	A	T	2: 23,984,783 (GRCm39)	N120K	probably benign	Het
Unc5b	A	T	10: 60,602,771 (GRCm39)	L876Q	probably damaging	Het
Usp9y	T	C	Y: 1,356,282 (GRCm39)	T1140A	probably benign	Homo
Vmn1r40	A	G	6: 89,691,326 (GRCm39)	I48V	probably benign	Het
Zbbx	T	C	3: 74,945,299 (GRCm39)	I708V	possibly damaging	Het
Zfp318	AGAAGA	AGAAGAGGAAGA	17: 46,723,446 (GRCm39)		probably benign	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	71,233,327 (GRCm39)	splice site	probably benign
IGL01411:Mast3	APN	8	71,232,227 (GRCm39)	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	71,232,174 (GRCm39)	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	71,234,783 (GRCm39)	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	71,240,550 (GRCm39)	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	71,241,888 (GRCm39)	missense	probably benign	0.36
IGL02437:Mast3	APN	8	71,233,202 (GRCm39)	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	71,239,519 (GRCm39)	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	71,241,861 (GRCm39)	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	71,234,207 (GRCm39)	nonsense	probably null
gravy	UTSW	8	71,239,279 (GRCm39)	missense	probably damaging	1.00
stuffing	UTSW	8	71,237,441 (GRCm39)	frame shift	probably null
turkey	UTSW	8	71,238,126 (GRCm39)	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	71,239,279 (GRCm39)	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	71,239,279 (GRCm39)	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	71,236,343 (GRCm39)	critical splice donor site	probably null
R0280:Mast3	UTSW	8	71,240,564 (GRCm39)	missense	possibly damaging	0.65
R0280:Mast3	UTSW	8	71,236,439 (GRCm39)	missense	probably damaging	1.00
R0731:Mast3	UTSW	8	71,233,965 (GRCm39)	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	71,239,307 (GRCm39)	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	71,232,968 (GRCm39)	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	71,240,916 (GRCm39)	splice site	probably null
R1333:Mast3	UTSW	8	71,233,938 (GRCm39)	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	71,244,955 (GRCm39)	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	71,238,816 (GRCm39)	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	71,237,200 (GRCm39)	missense	probably benign	0.38
R1842:Mast3	UTSW	8	71,233,037 (GRCm39)	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	71,237,444 (GRCm39)	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	71,240,007 (GRCm39)	missense	probably benign	0.00
R2219:Mast3	UTSW	8	71,233,607 (GRCm39)	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	71,233,607 (GRCm39)	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	71,232,251 (GRCm39)	missense	probably benign	0.13
R3919:Mast3	UTSW	8	71,232,066 (GRCm39)	missense	probably benign	0.02
R4027:Mast3	UTSW	8	71,240,552 (GRCm39)	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	71,233,838 (GRCm39)	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	71,233,838 (GRCm39)	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	71,233,838 (GRCm39)	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	71,233,838 (GRCm39)	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	71,233,251 (GRCm39)	nonsense	probably null
R4672:Mast3	UTSW	8	71,237,441 (GRCm39)	frame shift	probably null
R4770:Mast3	UTSW	8	71,238,864 (GRCm39)	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	71,233,010 (GRCm39)	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	71,241,559 (GRCm39)	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	71,240,889 (GRCm39)	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	71,236,145 (GRCm39)	missense	probably benign	0.03
R5428:Mast3	UTSW	8	71,237,377 (GRCm39)	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	71,238,865 (GRCm39)	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	71,240,577 (GRCm39)	missense	probably benign	0.00
R6177:Mast3	UTSW	8	71,242,662 (GRCm39)	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	71,238,127 (GRCm39)	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	71,234,772 (GRCm39)	missense	probably benign	0.02
R6614:Mast3	UTSW	8	71,234,610 (GRCm39)	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	71,239,376 (GRCm39)	missense	probably benign	0.29
R6873:Mast3	UTSW	8	71,239,236 (GRCm39)	nonsense	probably null
R6930:Mast3	UTSW	8	71,252,115 (GRCm39)	nonsense	probably null
R6948:Mast3	UTSW	8	71,238,126 (GRCm39)	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	71,232,117 (GRCm39)	missense	probably benign	0.14
R7253:Mast3	UTSW	8	71,242,326 (GRCm39)	critical splice donor site	probably null
R7316:Mast3	UTSW	8	71,232,432 (GRCm39)	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	71,237,503 (GRCm39)	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	71,238,815 (GRCm39)	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	71,232,947 (GRCm39)	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	71,232,947 (GRCm39)	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	71,241,412 (GRCm39)	missense	probably benign	0.16
R7576:Mast3	UTSW	8	71,233,838 (GRCm39)	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	71,239,279 (GRCm39)	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	71,236,214 (GRCm39)	missense	probably benign
R8021:Mast3	UTSW	8	71,240,896 (GRCm39)	missense	probably benign	0.02
R8204:Mast3	UTSW	8	71,240,925 (GRCm39)	missense	probably benign	0.00
R8327:Mast3	UTSW	8	71,232,062 (GRCm39)	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	71,233,085 (GRCm39)	missense	probably benign	0.39
R8415:Mast3	UTSW	8	71,233,866 (GRCm39)	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	71,233,085 (GRCm39)	missense	probably benign	0.39
R8530:Mast3	UTSW	8	71,240,877 (GRCm39)	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	71,233,801 (GRCm39)	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	71,234,377 (GRCm39)	splice site	probably benign
R9002:Mast3	UTSW	8	71,233,904 (GRCm39)	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	71,249,361 (GRCm39)	missense	unknown
R9087:Mast3	UTSW	8	71,242,330 (GRCm39)	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	71,233,091 (GRCm39)	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	71,238,826 (GRCm39)	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	71,238,127 (GRCm39)	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	71,241,682 (GRCm39)	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGATGAGCAGCTTTCGGACCAG -3'
(R):5'- CCAGCTCTGATCAATGCTGTCAGTC -3'

Sequencing Primer
(F):5'- AGCTGCACTATGAAGCCC -3'
(R):5'- GTCCTGTCTGACGATAGCC -3'

Posted On

2014-03-28