Incidental Mutation 'R1471:Fmn1'
ID164855
Institutional Source Beutler Lab
Gene Symbol Fmn1
Ensembl Gene ENSMUSG00000044042
Gene Nameformin 1
SynonymsFmn, formin-1
MMRRC Submission 039524-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock #R1471 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location113327736-113716767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113693094 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1141 (F1141L)
Ref Sequence ENSEMBL: ENSMUSP00000080093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081349] [ENSMUST00000099576] [ENSMUST00000102547] [ENSMUST00000161731]
PDB Structure
FBP28WW2 domain in complex with the PPLIPPPP peptide [SOLUTION NMR]
FBP28WW2 domain in complex with PTPPPLPP peptide [SOLUTION NMR]
FBP28WW2 domain in complex with a PPPLIPPPP peptide [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081349
AA Change: F1141L

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080093
Gene: ENSMUSG00000044042
AA Change: F1141L

DomainStartEndE-ValueType
Blast:FH2 25 641 N/A BLAST
SCOP:d1jvr__ 668 699 2e-3 SMART
FH2 757 1162 1.16e-137 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000099576
AA Change: F1367L

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097171
Gene: ENSMUSG00000044042
AA Change: F1367L

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1388 1.16e-137 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102547
AA Change: F1403L

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099606
Gene: ENSMUSG00000044042
AA Change: F1403L

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1424 1.03e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152255
Predicted Effect possibly damaging
Transcript: ENSMUST00000161731
AA Change: F1269L

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125052
Gene: ENSMUSG00000044042
AA Change: F1269L

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 619 1e-62 BLAST
Blast:FH2 625 765 3e-53 BLAST
SCOP:d1jvr__ 796 827 2e-3 SMART
FH2 885 1290 1.16e-137 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the formin homology family and encodes a protein that has a role in the formation of adherens junction and the polymerization of linear actin cables. The homologous gene in mouse is associated with limb deformity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous, irradiation-induced, and transgene-insertional mutations show severe syndactyly and oligodactyly of the feet, abnormal long bones (including radius-ulna fusions), and reduced or absent kidneys. Many mutants survive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,222 M255K probably damaging Het
4930486L24Rik C A 13: 60,853,522 K130N probably damaging Het
Adam6a T A 12: 113,544,393 S129T probably damaging Het
Adamts10 T A 17: 33,553,138 F1087I probably damaging Het
Afp T A 5: 90,503,682 N385K possibly damaging Het
Ahnak T G 19: 9,012,932 probably benign Het
Akap6 A G 12: 53,141,496 T1898A probably benign Het
Antxr2 C A 5: 97,975,340 V283F possibly damaging Het
Asgr1 T C 11: 70,056,093 V55A possibly damaging Het
Asxl3 A G 18: 22,516,354 K467E probably damaging Het
Atp5a1 C A 18: 77,781,269 Q398K probably damaging Het
Atxn2 T A 5: 121,786,374 D455E probably damaging Het
B4galt6 C T 18: 20,745,353 A39T possibly damaging Het
C130073F10Rik C T 4: 101,890,338 E165K probably benign Het
Cabin1 A G 10: 75,694,792 C1519R probably damaging Het
Casp8ap2 C T 4: 32,639,386 R147* probably null Het
Ccdc109b T A 3: 129,915,815 Y283F probably damaging Het
Ccdc88b A G 19: 6,854,023 L517P probably benign Het
Cd109 G A 9: 78,654,587 V220I probably damaging Het
Cd2ap T C 17: 42,820,597 K369R probably benign Het
Cd300c A G 11: 114,959,788 V63A probably benign Het
Cnot10 A G 9: 114,591,551 V741A probably benign Het
Col18a1 G T 10: 77,096,206 Q350K unknown Het
Crnkl1 T C 2: 145,932,316 K76E possibly damaging Het
Cryzl2 A G 1: 157,470,721 K227E probably benign Het
Cts6 G A 13: 61,196,380 T286I probably benign Het
Cul1 T C 6: 47,514,886 V392A probably damaging Het
Dcaf7 T A 11: 106,046,747 F65L probably benign Het
Dgke A C 11: 89,055,494 V160G possibly damaging Het
Dock8 C A 19: 25,201,036 Q2098K possibly damaging Het
Efhb T A 17: 53,399,112 D799V possibly damaging Het
Ephb2 T C 4: 136,658,951 D829G probably benign Het
Exosc1 A T 19: 41,924,718 S117R probably damaging Het
Fga T C 3: 83,028,618 S51P probably benign Het
Foxm1 C T 6: 128,373,874 L713F probably damaging Het
Galnt4 A G 10: 99,108,674 E87G probably benign Het
Gamt T C 10: 80,260,858 D15G probably benign Het
Gm13101 T C 4: 143,964,953 N400S probably benign Het
Gm15557 C A 2: 155,942,254 D154E possibly damaging Het
Gnptab A G 10: 88,445,763 I1211V probably benign Het
Greb1 A T 12: 16,711,774 M535K probably damaging Het
Grm8 C A 6: 27,363,309 A736S possibly damaging Het
Hspa14 T C 2: 3,491,608 I373M probably benign Het
Ifi207 T A 1: 173,730,063 T370S unknown Het
Igf1r A G 7: 68,003,837 N41S probably damaging Het
Ikzf5 A T 7: 131,391,767 V224D probably damaging Het
Il10 C A 1: 131,021,373 Y90* probably null Het
Itga4 A G 2: 79,287,032 D394G probably benign Het
Kif21a A T 15: 90,956,419 S1165T probably benign Het
Krtap14 A G 16: 88,825,627 S155P probably damaging Het
Loxl2 A G 14: 69,693,097 N770S probably benign Het
Man2b1 A G 8: 85,086,845 D222G probably damaging Het
Meis3 T A 7: 16,177,571 Y64* probably null Het
Mfsd6 T A 1: 52,709,557 I50F probably benign Het
Micu2 T C 14: 57,945,397 T165A probably damaging Het
Mtcl1 T C 17: 66,379,148 E921G probably damaging Het
Muc5b A T 7: 141,843,234 N215Y unknown Het
Muc6 A G 7: 141,647,909 F772L possibly damaging Het
Myt1 A G 2: 181,797,111 D142G probably benign Het
Nol6 C T 4: 41,120,281 V479I probably benign Het
Nsun7 A G 5: 66,284,229 K414E probably benign Het
Nup210l A C 3: 90,170,562 I914L probably benign Het
Obox3 G A 7: 15,626,950 P88L probably benign Het
Olfr1098 C T 2: 86,922,578 probably null Het
Olfr1122 A G 2: 87,388,518 Y271C probably damaging Het
Olfr1132 T C 2: 87,635,670 T26A probably benign Het
Olfr1289 T C 2: 111,484,006 L192P probably damaging Het
Pclo T C 5: 14,680,427 probably benign Het
Pcsk5 T C 19: 17,568,324 N745D probably damaging Het
Pdzrn3 T A 6: 101,151,512 N731I possibly damaging Het
Pkdrej T A 15: 85,817,133 Q1534L probably benign Het
Rell1 T A 5: 63,936,085 D109V probably damaging Het
Rplp0 C T 5: 115,563,344 T285I probably damaging Het
Sema3g C T 14: 31,228,045 R728C probably damaging Het
Slc15a2 A G 16: 36,753,791 Y536H probably damaging Het
Slc26a5 T A 5: 21,816,964 Y488F probably benign Het
Slc5a4a A T 10: 76,186,528 S566C probably damaging Het
Spink7 C T 18: 62,596,204 E21K possibly damaging Het
Src C T 2: 157,457,187 Q35* probably null Het
Srrm2 T A 17: 23,820,796 V2234E probably damaging Het
Stk36 A T 1: 74,611,155 Q282L probably benign Het
Tas2r118 T G 6: 23,969,171 E297A probably damaging Het
Terf1 A G 1: 15,842,970 Y385C probably damaging Het
Tmc3 T C 7: 83,598,290 S198P probably damaging Het
Tmprss11b C T 5: 86,660,496 R407H possibly damaging Het
Tspyl4 G A 10: 34,298,111 E200K probably damaging Het
Ttc21a T C 9: 119,942,641 Y169H probably damaging Het
Ugt2b36 C T 5: 87,092,071 D152N probably damaging Het
Unk T C 11: 116,049,409 I196T probably benign Het
Uroc1 T G 6: 90,344,171 V243G probably damaging Het
Usp34 C A 11: 23,488,862 Q3475K probably benign Het
Vmn2r117 T A 17: 23,478,473 I82L probably benign Het
Vmn2r44 A T 7: 8,377,883 V337E probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp362 T C 4: 128,787,200 T111A probably benign Het
Zfp598 T C 17: 24,680,072 V615A probably benign Het
Other mutations in Fmn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Fmn1 APN 2 113444467 intron probably benign
IGL01520:Fmn1 APN 2 113444368 intron probably benign
IGL02039:Fmn1 APN 2 113365080 missense unknown
IGL02222:Fmn1 APN 2 113593109 missense probably damaging 1.00
IGL02238:Fmn1 APN 2 113582125 missense possibly damaging 0.90
IGL02373:Fmn1 APN 2 113364126 missense unknown
IGL02490:Fmn1 APN 2 113529472 splice site probably benign
IGL02506:Fmn1 APN 2 113525295 missense unknown
IGL02684:Fmn1 APN 2 113525277 missense unknown
IGL03008:Fmn1 APN 2 113365100 missense unknown
IGL03058:Fmn1 APN 2 113441814 intron probably benign
IGL03076:Fmn1 APN 2 113584092 missense probably damaging 0.99
FR4304:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4304:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4342:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525773 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525778 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525781 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525784 small insertion probably benign
R0349:Fmn1 UTSW 2 113365796 missense unknown
R0452:Fmn1 UTSW 2 113636779 missense possibly damaging 0.46
R0529:Fmn1 UTSW 2 113707853 splice site probably benign
R1215:Fmn1 UTSW 2 113693030 nonsense probably null
R1489:Fmn1 UTSW 2 113365212 missense unknown
R1491:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R1551:Fmn1 UTSW 2 113525862 missense possibly damaging 0.70
R1558:Fmn1 UTSW 2 113693118 missense possibly damaging 0.46
R1588:Fmn1 UTSW 2 113365698 missense unknown
R1602:Fmn1 UTSW 2 113525623 missense unknown
R1690:Fmn1 UTSW 2 113525482 missense unknown
R1772:Fmn1 UTSW 2 113365355 missense unknown
R1867:Fmn1 UTSW 2 113709438 missense probably damaging 1.00
R1923:Fmn1 UTSW 2 113429721 intron probably benign
R1941:Fmn1 UTSW 2 113365143 missense unknown
R2019:Fmn1 UTSW 2 113364480 missense unknown
R2140:Fmn1 UTSW 2 113595048 missense probably benign 0.45
R2164:Fmn1 UTSW 2 113365617 missense unknown
R2395:Fmn1 UTSW 2 113365181 missense unknown
R2999:Fmn1 UTSW 2 113365094 missense unknown
R3405:Fmn1 UTSW 2 113364348 missense unknown
R3407:Fmn1 UTSW 2 113365055 missense unknown
R3771:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3772:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3773:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3777:Fmn1 UTSW 2 113365122 missense unknown
R4166:Fmn1 UTSW 2 113636735 missense probably benign 0.33
R4477:Fmn1 UTSW 2 113444399 intron probably benign
R4614:Fmn1 UTSW 2 113365149 missense unknown
R4701:Fmn1 UTSW 2 113584071 missense possibly damaging 0.76
R4867:Fmn1 UTSW 2 113584120 critical splice donor site probably null
R5063:Fmn1 UTSW 2 113364921 missense unknown
R5224:Fmn1 UTSW 2 113365125 missense unknown
R5510:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R6083:Fmn1 UTSW 2 113364303 missense unknown
R6234:Fmn1 UTSW 2 113365655 missense unknown
R6266:Fmn1 UTSW 2 113596338 missense probably damaging 1.00
R6764:Fmn1 UTSW 2 113525215 missense unknown
Z1088:Fmn1 UTSW 2 113441925 intron probably benign
Predicted Primers PCR Primer
(F):5'- GTAACTGTGAACCCTGACTCCTGTG -3'
(R):5'- GGGCTGCAAGTTCTCCCTGAATTTC -3'

Sequencing Primer
(F):5'- ACATGTGAGAAGCTGCCC -3'
(R):5'- TTCTCTGGGAACTCTGAGACAAG -3'
Posted On2014-03-28