Incidental Mutation 'R1471:Src'
ID164858
Institutional Source Beutler Lab
Gene Symbol Src
Ensembl Gene ENSMUSG00000027646
Gene NameRous sarcoma oncogene
Synonymspp60c-src
MMRRC Submission 039524-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1471 (G1)
Quality Score153
Status Not validated
Chromosome2
Chromosomal Location157418444-157471862 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 157457187 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 35 (Q35*)
Ref Sequence ENSEMBL: ENSMUSP00000105159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029175] [ENSMUST00000092576] [ENSMUST00000109529] [ENSMUST00000109531] [ENSMUST00000109533]
Predicted Effect probably null
Transcript: ENSMUST00000029175
AA Change: Q35*
SMART Domains Protein: ENSMUSP00000029175
Gene: ENSMUSG00000027646
AA Change: Q35*

DomainStartEndE-ValueType
SH3 86 143 2.48e-21 SMART
SH2 148 238 6.56e-37 SMART
TyrKc 269 518 2.97e-131 SMART
Predicted Effect probably null
Transcript: ENSMUST00000092576
AA Change: Q35*
SMART Domains Protein: ENSMUSP00000090237
Gene: ENSMUSG00000027646
AA Change: Q35*

DomainStartEndE-ValueType
SH3 86 149 1.2e-19 SMART
SH2 154 244 6.56e-37 SMART
TyrKc 275 524 2.97e-131 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109529
AA Change: Q35*
SMART Domains Protein: ENSMUSP00000105155
Gene: ENSMUSG00000027646
AA Change: Q35*

DomainStartEndE-ValueType
SH3 86 149 1.2e-19 SMART
SH2 154 244 6.56e-37 SMART
TyrKc 275 524 2.97e-131 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109531
AA Change: Q35*
SMART Domains Protein: ENSMUSP00000105157
Gene: ENSMUSG00000027646
AA Change: Q35*

DomainStartEndE-ValueType
SH3 86 143 2.48e-21 SMART
SH2 148 238 6.56e-37 SMART
TyrKc 269 518 2.97e-131 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109533
AA Change: Q35*
SMART Domains Protein: ENSMUSP00000105159
Gene: ENSMUSG00000027646
AA Change: Q35*

DomainStartEndE-ValueType
SH3 86 143 2.48e-21 SMART
SH2 148 238 6.56e-37 SMART
TyrKc 269 518 2.97e-131 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145715
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is highly similar to the v-src gene of Rous sarcoma virus. This proto-oncogene may play a role in the regulation of embryonic development and cell growth. The protein encoded by this gene is a tyrosine-protein kinase whose activity can be inhibited by phosphorylation by c-SRC kinase. Mutations in this gene could be involved in the malignant progression of colon cancer. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit growth retardation, failure of tooth eruption, osteopetrosis with lack of secondary bone resorption, and lethality at 3-4 weeks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,222 M255K probably damaging Het
4930486L24Rik C A 13: 60,853,522 K130N probably damaging Het
Adam6a T A 12: 113,544,393 S129T probably damaging Het
Adamts10 T A 17: 33,553,138 F1087I probably damaging Het
Afp T A 5: 90,503,682 N385K possibly damaging Het
Ahnak T G 19: 9,012,932 probably benign Het
Akap6 A G 12: 53,141,496 T1898A probably benign Het
Antxr2 C A 5: 97,975,340 V283F possibly damaging Het
Asgr1 T C 11: 70,056,093 V55A possibly damaging Het
Asxl3 A G 18: 22,516,354 K467E probably damaging Het
Atp5a1 C A 18: 77,781,269 Q398K probably damaging Het
Atxn2 T A 5: 121,786,374 D455E probably damaging Het
B4galt6 C T 18: 20,745,353 A39T possibly damaging Het
C130073F10Rik C T 4: 101,890,338 E165K probably benign Het
Cabin1 A G 10: 75,694,792 C1519R probably damaging Het
Casp8ap2 C T 4: 32,639,386 R147* probably null Het
Ccdc109b T A 3: 129,915,815 Y283F probably damaging Het
Ccdc88b A G 19: 6,854,023 L517P probably benign Het
Cd109 G A 9: 78,654,587 V220I probably damaging Het
Cd2ap T C 17: 42,820,597 K369R probably benign Het
Cd300c A G 11: 114,959,788 V63A probably benign Het
Cnot10 A G 9: 114,591,551 V741A probably benign Het
Col18a1 G T 10: 77,096,206 Q350K unknown Het
Crnkl1 T C 2: 145,932,316 K76E possibly damaging Het
Cryzl2 A G 1: 157,470,721 K227E probably benign Het
Cts6 G A 13: 61,196,380 T286I probably benign Het
Cul1 T C 6: 47,514,886 V392A probably damaging Het
Dcaf7 T A 11: 106,046,747 F65L probably benign Het
Dgke A C 11: 89,055,494 V160G possibly damaging Het
Dock8 C A 19: 25,201,036 Q2098K possibly damaging Het
Efhb T A 17: 53,399,112 D799V possibly damaging Het
Ephb2 T C 4: 136,658,951 D829G probably benign Het
Exosc1 A T 19: 41,924,718 S117R probably damaging Het
Fga T C 3: 83,028,618 S51P probably benign Het
Fmn1 T C 2: 113,693,094 F1141L possibly damaging Het
Foxm1 C T 6: 128,373,874 L713F probably damaging Het
Galnt4 A G 10: 99,108,674 E87G probably benign Het
Gamt T C 10: 80,260,858 D15G probably benign Het
Gm13101 T C 4: 143,964,953 N400S probably benign Het
Gm15557 C A 2: 155,942,254 D154E possibly damaging Het
Gnptab A G 10: 88,445,763 I1211V probably benign Het
Greb1 A T 12: 16,711,774 M535K probably damaging Het
Grm8 C A 6: 27,363,309 A736S possibly damaging Het
Hspa14 T C 2: 3,491,608 I373M probably benign Het
Ifi207 T A 1: 173,730,063 T370S unknown Het
Igf1r A G 7: 68,003,837 N41S probably damaging Het
Ikzf5 A T 7: 131,391,767 V224D probably damaging Het
Il10 C A 1: 131,021,373 Y90* probably null Het
Itga4 A G 2: 79,287,032 D394G probably benign Het
Kif21a A T 15: 90,956,419 S1165T probably benign Het
Krtap14 A G 16: 88,825,627 S155P probably damaging Het
Loxl2 A G 14: 69,693,097 N770S probably benign Het
Man2b1 A G 8: 85,086,845 D222G probably damaging Het
Meis3 T A 7: 16,177,571 Y64* probably null Het
Mfsd6 T A 1: 52,709,557 I50F probably benign Het
Micu2 T C 14: 57,945,397 T165A probably damaging Het
Mtcl1 T C 17: 66,379,148 E921G probably damaging Het
Muc5b A T 7: 141,843,234 N215Y unknown Het
Muc6 A G 7: 141,647,909 F772L possibly damaging Het
Myt1 A G 2: 181,797,111 D142G probably benign Het
Nol6 C T 4: 41,120,281 V479I probably benign Het
Nsun7 A G 5: 66,284,229 K414E probably benign Het
Nup210l A C 3: 90,170,562 I914L probably benign Het
Obox3 G A 7: 15,626,950 P88L probably benign Het
Olfr1098 C T 2: 86,922,578 probably null Het
Olfr1122 A G 2: 87,388,518 Y271C probably damaging Het
Olfr1132 T C 2: 87,635,670 T26A probably benign Het
Olfr1289 T C 2: 111,484,006 L192P probably damaging Het
Pclo T C 5: 14,680,427 probably benign Het
Pcsk5 T C 19: 17,568,324 N745D probably damaging Het
Pdzrn3 T A 6: 101,151,512 N731I possibly damaging Het
Pkdrej T A 15: 85,817,133 Q1534L probably benign Het
Rell1 T A 5: 63,936,085 D109V probably damaging Het
Rplp0 C T 5: 115,563,344 T285I probably damaging Het
Sema3g C T 14: 31,228,045 R728C probably damaging Het
Slc15a2 A G 16: 36,753,791 Y536H probably damaging Het
Slc26a5 T A 5: 21,816,964 Y488F probably benign Het
Slc5a4a A T 10: 76,186,528 S566C probably damaging Het
Spink7 C T 18: 62,596,204 E21K possibly damaging Het
Srrm2 T A 17: 23,820,796 V2234E probably damaging Het
Stk36 A T 1: 74,611,155 Q282L probably benign Het
Tas2r118 T G 6: 23,969,171 E297A probably damaging Het
Terf1 A G 1: 15,842,970 Y385C probably damaging Het
Tmc3 T C 7: 83,598,290 S198P probably damaging Het
Tmprss11b C T 5: 86,660,496 R407H possibly damaging Het
Tspyl4 G A 10: 34,298,111 E200K probably damaging Het
Ttc21a T C 9: 119,942,641 Y169H probably damaging Het
Ugt2b36 C T 5: 87,092,071 D152N probably damaging Het
Unk T C 11: 116,049,409 I196T probably benign Het
Uroc1 T G 6: 90,344,171 V243G probably damaging Het
Usp34 C A 11: 23,488,862 Q3475K probably benign Het
Vmn2r117 T A 17: 23,478,473 I82L probably benign Het
Vmn2r44 A T 7: 8,377,883 V337E probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp362 T C 4: 128,787,200 T111A probably benign Het
Zfp598 T C 17: 24,680,072 V615A probably benign Het
Other mutations in Src
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Src APN 2 157469503 missense probably damaging 1.00
IGL01320:Src APN 2 157469503 missense probably damaging 1.00
IGL01323:Src APN 2 157469503 missense probably damaging 1.00
IGL01452:Src APN 2 157462983 missense probably damaging 1.00
IGL02618:Src APN 2 157464778 nonsense probably null
R0605:Src UTSW 2 157469921 missense probably damaging 1.00
R1457:Src UTSW 2 157469212 missense probably damaging 1.00
R1694:Src UTSW 2 157469755 missense possibly damaging 0.95
R2040:Src UTSW 2 157457110 missense probably benign 0.02
R2209:Src UTSW 2 157462790 missense probably benign 0.16
R4112:Src UTSW 2 157463026 missense probably damaging 1.00
R4414:Src UTSW 2 157464653 missense probably damaging 1.00
R4581:Src UTSW 2 157463038 missense probably damaging 0.98
R4661:Src UTSW 2 157469932 missense probably damaging 1.00
R4781:Src UTSW 2 157467485 missense possibly damaging 0.71
R5504:Src UTSW 2 157464721 missense probably damaging 1.00
R5913:Src UTSW 2 157466030 critical splice donor site probably null
R6166:Src UTSW 2 157468522 missense probably damaging 0.99
R6336:Src UTSW 2 157457155 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGGTGTAATGAGACGAGTCCTCCC -3'
(R):5'- ACGAATCCTTCCCCATTCGCAG -3'

Sequencing Primer
(F):5'- AGTTTCCCTATCCGATAAGTGG -3'
(R):5'- TCGCAGCCTCGGGAAAAC -3'
Posted On2014-03-28