Incidental Mutation 'R1471:Foxm1'
ID164886
Institutional Source Beutler Lab
Gene Symbol Foxm1
Ensembl Gene ENSMUSG00000001517
Gene Nameforkhead box M1
SynonymsWIN, Mpm2, Foxm1b, Trident, Fkh16, HFH-11B
MMRRC Submission 039524-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1471 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location128362967-128376146 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 128373874 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 713 (L713F)
Ref Sequence ENSEMBL: ENSMUSP00000107776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073316] [ENSMUST00000100926] [ENSMUST00000112148] [ENSMUST00000130785] [ENSMUST00000203040] [ENSMUST00000204223]
Predicted Effect probably damaging
Transcript: ENSMUST00000073316
AA Change: L728F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073041
Gene: ENSMUSG00000001517
AA Change: L728F

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 35 55 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 140 158 N/A INTRINSIC
FH 232 319 2.86e-42 SMART
low complexity region 429 454 N/A INTRINSIC
low complexity region 504 515 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
low complexity region 685 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100926
SMART Domains Protein: ENSMUSP00000098486
Gene: ENSMUSG00000079304

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Pfam:DUF4532 28 306 1.9e-158 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112148
AA Change: L713F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107776
Gene: ENSMUSG00000001517
AA Change: L713F

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 35 55 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 140 158 N/A INTRINSIC
FH 232 319 2.86e-42 SMART
low complexity region 414 439 N/A INTRINSIC
low complexity region 489 500 N/A INTRINSIC
low complexity region 518 531 N/A INTRINSIC
low complexity region 670 687 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125456
Predicted Effect probably benign
Transcript: ENSMUST00000130785
SMART Domains Protein: ENSMUSP00000145112
Gene: ENSMUSG00000079304

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Pfam:DUF4532 28 223 3.9e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153423
Predicted Effect probably benign
Transcript: ENSMUST00000203040
SMART Domains Protein: ENSMUSP00000145305
Gene: ENSMUSG00000001517

DomainStartEndE-ValueType
FH 78 165 1.2e-44 SMART
low complexity region 276 301 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
low complexity region 380 393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203779
Predicted Effect probably benign
Transcript: ENSMUST00000204223
SMART Domains Protein: ENSMUSP00000145012
Gene: ENSMUSG00000108011

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 190 201 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional activator involved in cell proliferation. The encoded protein is phosphorylated in M phase and regulates the expression of several cell cycle genes, such as cyclin B1 and cyclin D1. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a null allele die in utero exhibiting reduced hepatoblast mitosis, impaired liver, bile duct and lung development, myocardial defects and ventricular hypoplasia. Most homozygotes for another null allele die perinatally with myocardialdefects and polyploidy in heart and liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,222 M255K probably damaging Het
4930486L24Rik C A 13: 60,853,522 K130N probably damaging Het
Adam6a T A 12: 113,544,393 S129T probably damaging Het
Adamts10 T A 17: 33,553,138 F1087I probably damaging Het
Afp T A 5: 90,503,682 N385K possibly damaging Het
Ahnak T G 19: 9,012,932 probably benign Het
Akap6 A G 12: 53,141,496 T1898A probably benign Het
Antxr2 C A 5: 97,975,340 V283F possibly damaging Het
Asgr1 T C 11: 70,056,093 V55A possibly damaging Het
Asxl3 A G 18: 22,516,354 K467E probably damaging Het
Atp5a1 C A 18: 77,781,269 Q398K probably damaging Het
Atxn2 T A 5: 121,786,374 D455E probably damaging Het
B4galt6 C T 18: 20,745,353 A39T possibly damaging Het
C130073F10Rik C T 4: 101,890,338 E165K probably benign Het
Cabin1 A G 10: 75,694,792 C1519R probably damaging Het
Casp8ap2 C T 4: 32,639,386 R147* probably null Het
Ccdc109b T A 3: 129,915,815 Y283F probably damaging Het
Ccdc88b A G 19: 6,854,023 L517P probably benign Het
Cd109 G A 9: 78,654,587 V220I probably damaging Het
Cd2ap T C 17: 42,820,597 K369R probably benign Het
Cd300c A G 11: 114,959,788 V63A probably benign Het
Cnot10 A G 9: 114,591,551 V741A probably benign Het
Col18a1 G T 10: 77,096,206 Q350K unknown Het
Crnkl1 T C 2: 145,932,316 K76E possibly damaging Het
Cryzl2 A G 1: 157,470,721 K227E probably benign Het
Cts6 G A 13: 61,196,380 T286I probably benign Het
Cul1 T C 6: 47,514,886 V392A probably damaging Het
Dcaf7 T A 11: 106,046,747 F65L probably benign Het
Dgke A C 11: 89,055,494 V160G possibly damaging Het
Dock8 C A 19: 25,201,036 Q2098K possibly damaging Het
Efhb T A 17: 53,399,112 D799V possibly damaging Het
Ephb2 T C 4: 136,658,951 D829G probably benign Het
Exosc1 A T 19: 41,924,718 S117R probably damaging Het
Fga T C 3: 83,028,618 S51P probably benign Het
Fmn1 T C 2: 113,693,094 F1141L possibly damaging Het
Galnt4 A G 10: 99,108,674 E87G probably benign Het
Gamt T C 10: 80,260,858 D15G probably benign Het
Gm13101 T C 4: 143,964,953 N400S probably benign Het
Gm15557 C A 2: 155,942,254 D154E possibly damaging Het
Gnptab A G 10: 88,445,763 I1211V probably benign Het
Greb1 A T 12: 16,711,774 M535K probably damaging Het
Grm8 C A 6: 27,363,309 A736S possibly damaging Het
Hspa14 T C 2: 3,491,608 I373M probably benign Het
Ifi207 T A 1: 173,730,063 T370S unknown Het
Igf1r A G 7: 68,003,837 N41S probably damaging Het
Ikzf5 A T 7: 131,391,767 V224D probably damaging Het
Il10 C A 1: 131,021,373 Y90* probably null Het
Itga4 A G 2: 79,287,032 D394G probably benign Het
Kif21a A T 15: 90,956,419 S1165T probably benign Het
Krtap14 A G 16: 88,825,627 S155P probably damaging Het
Loxl2 A G 14: 69,693,097 N770S probably benign Het
Man2b1 A G 8: 85,086,845 D222G probably damaging Het
Meis3 T A 7: 16,177,571 Y64* probably null Het
Mfsd6 T A 1: 52,709,557 I50F probably benign Het
Micu2 T C 14: 57,945,397 T165A probably damaging Het
Mtcl1 T C 17: 66,379,148 E921G probably damaging Het
Muc5b A T 7: 141,843,234 N215Y unknown Het
Muc6 A G 7: 141,647,909 F772L possibly damaging Het
Myt1 A G 2: 181,797,111 D142G probably benign Het
Nol6 C T 4: 41,120,281 V479I probably benign Het
Nsun7 A G 5: 66,284,229 K414E probably benign Het
Nup210l A C 3: 90,170,562 I914L probably benign Het
Obox3 G A 7: 15,626,950 P88L probably benign Het
Olfr1098 C T 2: 86,922,578 probably null Het
Olfr1122 A G 2: 87,388,518 Y271C probably damaging Het
Olfr1132 T C 2: 87,635,670 T26A probably benign Het
Olfr1289 T C 2: 111,484,006 L192P probably damaging Het
Pclo T C 5: 14,680,427 probably benign Het
Pcsk5 T C 19: 17,568,324 N745D probably damaging Het
Pdzrn3 T A 6: 101,151,512 N731I possibly damaging Het
Pkdrej T A 15: 85,817,133 Q1534L probably benign Het
Rell1 T A 5: 63,936,085 D109V probably damaging Het
Rplp0 C T 5: 115,563,344 T285I probably damaging Het
Sema3g C T 14: 31,228,045 R728C probably damaging Het
Slc15a2 A G 16: 36,753,791 Y536H probably damaging Het
Slc26a5 T A 5: 21,816,964 Y488F probably benign Het
Slc5a4a A T 10: 76,186,528 S566C probably damaging Het
Spink7 C T 18: 62,596,204 E21K possibly damaging Het
Src C T 2: 157,457,187 Q35* probably null Het
Srrm2 T A 17: 23,820,796 V2234E probably damaging Het
Stk36 A T 1: 74,611,155 Q282L probably benign Het
Tas2r118 T G 6: 23,969,171 E297A probably damaging Het
Terf1 A G 1: 15,842,970 Y385C probably damaging Het
Tmc3 T C 7: 83,598,290 S198P probably damaging Het
Tmprss11b C T 5: 86,660,496 R407H possibly damaging Het
Tspyl4 G A 10: 34,298,111 E200K probably damaging Het
Ttc21a T C 9: 119,942,641 Y169H probably damaging Het
Ugt2b36 C T 5: 87,092,071 D152N probably damaging Het
Unk T C 11: 116,049,409 I196T probably benign Het
Uroc1 T G 6: 90,344,171 V243G probably damaging Het
Usp34 C A 11: 23,488,862 Q3475K probably benign Het
Vmn2r117 T A 17: 23,478,473 I82L probably benign Het
Vmn2r44 A T 7: 8,377,883 V337E probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp362 T C 4: 128,787,200 T111A probably benign Het
Zfp598 T C 17: 24,680,072 V615A probably benign Het
Other mutations in Foxm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Foxm1 APN 6 128370967 missense possibly damaging 0.94
IGL01312:Foxm1 APN 6 128373374 missense probably damaging 0.97
IGL01317:Foxm1 APN 6 128367353 missense probably damaging 0.98
IGL01683:Foxm1 APN 6 128373488 missense probably benign 0.01
IGL01837:Foxm1 APN 6 128366204 unclassified probably benign
IGL02039:Foxm1 APN 6 128369360 missense probably damaging 1.00
IGL02490:Foxm1 APN 6 128373351 nonsense probably null
IGL02685:Foxm1 APN 6 128373107 missense possibly damaging 0.89
IGL03335:Foxm1 APN 6 128372568 missense possibly damaging 0.92
R0374:Foxm1 UTSW 6 128372603 missense probably damaging 1.00
R0625:Foxm1 UTSW 6 128373871 missense probably damaging 1.00
R1420:Foxm1 UTSW 6 128372921 missense possibly damaging 0.94
R2013:Foxm1 UTSW 6 128375502 unclassified probably null
R4334:Foxm1 UTSW 6 128365967 missense probably damaging 1.00
R4753:Foxm1 UTSW 6 128372556 missense probably null 0.89
R4834:Foxm1 UTSW 6 128369447 missense probably damaging 1.00
R4997:Foxm1 UTSW 6 128365768 missense probably benign 0.06
R5657:Foxm1 UTSW 6 128373388 missense possibly damaging 0.95
R5666:Foxm1 UTSW 6 128373167 missense possibly damaging 0.69
R5763:Foxm1 UTSW 6 128366108 missense probably benign 0.06
R5982:Foxm1 UTSW 6 128371035 missense probably damaging 1.00
R6164:Foxm1 UTSW 6 128373935 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GGGGTTAGATTTCAGCCCAGTACG -3'
(R):5'- TGAGCCACACAAGTGCCAGGATAG -3'

Sequencing Primer
(F):5'- TTGATGGAGCTGAATACCACC -3'
(R):5'- ATAGCAGGCGGCTTGAGTG -3'
Posted On2014-03-28