Incidental Mutation 'R1471:Loxl2'
ID164929
Institutional Source Beutler Lab
Gene Symbol Loxl2
Ensembl Gene ENSMUSG00000034205
Gene Namelysyl oxidase-like 2
Synonyms9430067E15Rik, 1110004B06Rik
MMRRC Submission 039524-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.455) question?
Stock #R1471 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location69609068-69695834 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69693097 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 770 (N770S)
Ref Sequence ENSEMBL: ENSMUSP00000097987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022660] [ENSMUST00000100420] [ENSMUST00000118374] [ENSMUST00000121142] [ENSMUST00000216152]
Predicted Effect probably benign
Transcript: ENSMUST00000022660
AA Change: N770S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000022660
Gene: ENSMUSG00000034205
AA Change: N770S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SR 61 162 4.4e-53 SMART
SR 189 305 8.41e-18 SMART
SR 329 428 2.29e-51 SMART
SR 438 546 4.6e-33 SMART
Pfam:Lysyl_oxidase 550 753 1.9e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100420
AA Change: N770S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000097987
Gene: ENSMUSG00000034205
AA Change: N770S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SR 61 162 4.4e-53 SMART
SR 189 305 8.41e-18 SMART
SR 329 428 2.29e-51 SMART
SR 438 546 4.6e-33 SMART
Pfam:Lysyl_oxidase 550 750 1.1e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118374
SMART Domains Protein: ENSMUSP00000113450
Gene: ENSMUSG00000034194

DomainStartEndE-ValueType
coiled coil region 52 132 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121142
SMART Domains Protein: ENSMUSP00000113898
Gene: ENSMUSG00000034194

DomainStartEndE-ValueType
coiled coil region 52 132 N/A INTRINSIC
low complexity region 273 283 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184438
Predicted Effect probably benign
Transcript: ENSMUST00000216152
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lysyl oxidase gene family. The prototypic member of the family is essential to the biogenesis of connective tissue, encoding an extracellular copper-dependent amine oxidase that catalyses the first step in the formation of crosslinks in collagens and elastin. A highly conserved amino acid sequence at the C-terminus end appears to be sufficient for amine oxidase activity, suggesting that each family member may retain this function. The N-terminus is poorly conserved and may impart additional roles in developmental regulation, senescence, tumor suppression, cell growth control, and chemotaxis to each member of the family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show partial perinatal lethality associated with cardiac defects and distended liver blood vessels. Overexpressing mice display male sterility, testis degeneration, epididymal dysfunction, and increased tumor burden and malignant progression after DMBA-TPA treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,222 M255K probably damaging Het
4930486L24Rik C A 13: 60,853,522 K130N probably damaging Het
Adam6a T A 12: 113,544,393 S129T probably damaging Het
Adamts10 T A 17: 33,553,138 F1087I probably damaging Het
Afp T A 5: 90,503,682 N385K possibly damaging Het
Ahnak T G 19: 9,012,932 probably benign Het
Akap6 A G 12: 53,141,496 T1898A probably benign Het
Antxr2 C A 5: 97,975,340 V283F possibly damaging Het
Asgr1 T C 11: 70,056,093 V55A possibly damaging Het
Asxl3 A G 18: 22,516,354 K467E probably damaging Het
Atp5a1 C A 18: 77,781,269 Q398K probably damaging Het
Atxn2 T A 5: 121,786,374 D455E probably damaging Het
B4galt6 C T 18: 20,745,353 A39T possibly damaging Het
C130073F10Rik C T 4: 101,890,338 E165K probably benign Het
Cabin1 A G 10: 75,694,792 C1519R probably damaging Het
Casp8ap2 C T 4: 32,639,386 R147* probably null Het
Ccdc109b T A 3: 129,915,815 Y283F probably damaging Het
Ccdc88b A G 19: 6,854,023 L517P probably benign Het
Cd109 G A 9: 78,654,587 V220I probably damaging Het
Cd2ap T C 17: 42,820,597 K369R probably benign Het
Cd300c A G 11: 114,959,788 V63A probably benign Het
Cnot10 A G 9: 114,591,551 V741A probably benign Het
Col18a1 G T 10: 77,096,206 Q350K unknown Het
Crnkl1 T C 2: 145,932,316 K76E possibly damaging Het
Cryzl2 A G 1: 157,470,721 K227E probably benign Het
Cts6 G A 13: 61,196,380 T286I probably benign Het
Cul1 T C 6: 47,514,886 V392A probably damaging Het
Dcaf7 T A 11: 106,046,747 F65L probably benign Het
Dgke A C 11: 89,055,494 V160G possibly damaging Het
Dock8 C A 19: 25,201,036 Q2098K possibly damaging Het
Efhb T A 17: 53,399,112 D799V possibly damaging Het
Ephb2 T C 4: 136,658,951 D829G probably benign Het
Exosc1 A T 19: 41,924,718 S117R probably damaging Het
Fga T C 3: 83,028,618 S51P probably benign Het
Fmn1 T C 2: 113,693,094 F1141L possibly damaging Het
Foxm1 C T 6: 128,373,874 L713F probably damaging Het
Galnt4 A G 10: 99,108,674 E87G probably benign Het
Gamt T C 10: 80,260,858 D15G probably benign Het
Gm13101 T C 4: 143,964,953 N400S probably benign Het
Gm15557 C A 2: 155,942,254 D154E possibly damaging Het
Gnptab A G 10: 88,445,763 I1211V probably benign Het
Greb1 A T 12: 16,711,774 M535K probably damaging Het
Grm8 C A 6: 27,363,309 A736S possibly damaging Het
Hspa14 T C 2: 3,491,608 I373M probably benign Het
Ifi207 T A 1: 173,730,063 T370S unknown Het
Igf1r A G 7: 68,003,837 N41S probably damaging Het
Ikzf5 A T 7: 131,391,767 V224D probably damaging Het
Il10 C A 1: 131,021,373 Y90* probably null Het
Itga4 A G 2: 79,287,032 D394G probably benign Het
Kif21a A T 15: 90,956,419 S1165T probably benign Het
Krtap14 A G 16: 88,825,627 S155P probably damaging Het
Man2b1 A G 8: 85,086,845 D222G probably damaging Het
Meis3 T A 7: 16,177,571 Y64* probably null Het
Mfsd6 T A 1: 52,709,557 I50F probably benign Het
Micu2 T C 14: 57,945,397 T165A probably damaging Het
Mtcl1 T C 17: 66,379,148 E921G probably damaging Het
Muc5b A T 7: 141,843,234 N215Y unknown Het
Muc6 A G 7: 141,647,909 F772L possibly damaging Het
Myt1 A G 2: 181,797,111 D142G probably benign Het
Nol6 C T 4: 41,120,281 V479I probably benign Het
Nsun7 A G 5: 66,284,229 K414E probably benign Het
Nup210l A C 3: 90,170,562 I914L probably benign Het
Obox3 G A 7: 15,626,950 P88L probably benign Het
Olfr1098 C T 2: 86,922,578 probably null Het
Olfr1122 A G 2: 87,388,518 Y271C probably damaging Het
Olfr1132 T C 2: 87,635,670 T26A probably benign Het
Olfr1289 T C 2: 111,484,006 L192P probably damaging Het
Pclo T C 5: 14,680,427 probably benign Het
Pcsk5 T C 19: 17,568,324 N745D probably damaging Het
Pdzrn3 T A 6: 101,151,512 N731I possibly damaging Het
Pkdrej T A 15: 85,817,133 Q1534L probably benign Het
Rell1 T A 5: 63,936,085 D109V probably damaging Het
Rplp0 C T 5: 115,563,344 T285I probably damaging Het
Sema3g C T 14: 31,228,045 R728C probably damaging Het
Slc15a2 A G 16: 36,753,791 Y536H probably damaging Het
Slc26a5 T A 5: 21,816,964 Y488F probably benign Het
Slc5a4a A T 10: 76,186,528 S566C probably damaging Het
Spink7 C T 18: 62,596,204 E21K possibly damaging Het
Src C T 2: 157,457,187 Q35* probably null Het
Srrm2 T A 17: 23,820,796 V2234E probably damaging Het
Stk36 A T 1: 74,611,155 Q282L probably benign Het
Tas2r118 T G 6: 23,969,171 E297A probably damaging Het
Terf1 A G 1: 15,842,970 Y385C probably damaging Het
Tmc3 T C 7: 83,598,290 S198P probably damaging Het
Tmprss11b C T 5: 86,660,496 R407H possibly damaging Het
Tspyl4 G A 10: 34,298,111 E200K probably damaging Het
Ttc21a T C 9: 119,942,641 Y169H probably damaging Het
Ugt2b36 C T 5: 87,092,071 D152N probably damaging Het
Unk T C 11: 116,049,409 I196T probably benign Het
Uroc1 T G 6: 90,344,171 V243G probably damaging Het
Usp34 C A 11: 23,488,862 Q3475K probably benign Het
Vmn2r117 T A 17: 23,478,473 I82L probably benign Het
Vmn2r44 A T 7: 8,377,883 V337E probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp362 T C 4: 128,787,200 T111A probably benign Het
Zfp598 T C 17: 24,680,072 V615A probably benign Het
Other mutations in Loxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0020:Loxl2 UTSW 14 69660793 missense probably damaging 0.99
R0149:Loxl2 UTSW 14 69693078 missense probably benign 0.34
R1448:Loxl2 UTSW 14 69693040 missense probably damaging 1.00
R1743:Loxl2 UTSW 14 69692402 missense possibly damaging 0.90
R2124:Loxl2 UTSW 14 69692410 missense probably benign 0.08
R2289:Loxl2 UTSW 14 69693075 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CAAGGAGAAAAGCAGCTTTTGTCCC -3'
(R):5'- TGTTCCCAGAAGAAAACGGCCC -3'

Sequencing Primer
(F):5'- ACACTCTCTGAACTTTGGCAAG -3'
(R):5'- cctttcttccttccttccttcc -3'
Posted On2014-03-28