Incidental Mutation 'R1471:Pkdrej'
ID164930
Institutional Source Beutler Lab
Gene Symbol Pkdrej
Ensembl Gene ENSMUSG00000052496
Gene Namepolycystin (PKD) family receptor for egg jelly
Synonyms
MMRRC Submission 039524-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R1471 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location85814670-85821734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85817133 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1534 (Q1534L)
Ref Sequence ENSEMBL: ENSMUSP00000086352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064370]
Predicted Effect probably benign
Transcript: ENSMUST00000064370
AA Change: Q1534L

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000086352
Gene: ENSMUSG00000052496
AA Change: Q1534L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:REJ 130 598 6.2e-116 PFAM
coiled coil region 657 687 N/A INTRINSIC
low complexity region 942 947 N/A INTRINSIC
GPS 984 1050 1.37e-2 SMART
transmembrane domain 1067 1089 N/A INTRINSIC
LH2 1114 1230 3.35e-6 SMART
transmembrane domain 1274 1292 N/A INTRINSIC
transmembrane domain 1312 1334 N/A INTRINSIC
low complexity region 1407 1415 N/A INTRINSIC
transmembrane domain 1451 1473 N/A INTRINSIC
transmembrane domain 1483 1505 N/A INTRINSIC
low complexity region 1571 1579 N/A INTRINSIC
transmembrane domain 1581 1603 N/A INTRINSIC
Pfam:PKD_channel 1621 2051 5.2e-154 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a receptor for egg jelly (REJ) domain, a G-protein-coupled receptor proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may play a role in human reproduction. Alternative splice variants have been described but their biological natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null males are fertile in unrestricted mating trials but show lower reproductive success in sequential mating and artificial insemination trials. Although mutant sperm are able to capacitate in vitro, they acquire exocytotic competence at a slower rate than wild-type sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,222 M255K probably damaging Het
4930486L24Rik C A 13: 60,853,522 K130N probably damaging Het
Adam6a T A 12: 113,544,393 S129T probably damaging Het
Adamts10 T A 17: 33,553,138 F1087I probably damaging Het
Afp T A 5: 90,503,682 N385K possibly damaging Het
Ahnak T G 19: 9,012,932 probably benign Het
Akap6 A G 12: 53,141,496 T1898A probably benign Het
Antxr2 C A 5: 97,975,340 V283F possibly damaging Het
Asgr1 T C 11: 70,056,093 V55A possibly damaging Het
Asxl3 A G 18: 22,516,354 K467E probably damaging Het
Atp5a1 C A 18: 77,781,269 Q398K probably damaging Het
Atxn2 T A 5: 121,786,374 D455E probably damaging Het
B4galt6 C T 18: 20,745,353 A39T possibly damaging Het
C130073F10Rik C T 4: 101,890,338 E165K probably benign Het
Cabin1 A G 10: 75,694,792 C1519R probably damaging Het
Casp8ap2 C T 4: 32,639,386 R147* probably null Het
Ccdc109b T A 3: 129,915,815 Y283F probably damaging Het
Ccdc88b A G 19: 6,854,023 L517P probably benign Het
Cd109 G A 9: 78,654,587 V220I probably damaging Het
Cd2ap T C 17: 42,820,597 K369R probably benign Het
Cd300c A G 11: 114,959,788 V63A probably benign Het
Cnot10 A G 9: 114,591,551 V741A probably benign Het
Col18a1 G T 10: 77,096,206 Q350K unknown Het
Crnkl1 T C 2: 145,932,316 K76E possibly damaging Het
Cryzl2 A G 1: 157,470,721 K227E probably benign Het
Cts6 G A 13: 61,196,380 T286I probably benign Het
Cul1 T C 6: 47,514,886 V392A probably damaging Het
Dcaf7 T A 11: 106,046,747 F65L probably benign Het
Dgke A C 11: 89,055,494 V160G possibly damaging Het
Dock8 C A 19: 25,201,036 Q2098K possibly damaging Het
Efhb T A 17: 53,399,112 D799V possibly damaging Het
Ephb2 T C 4: 136,658,951 D829G probably benign Het
Exosc1 A T 19: 41,924,718 S117R probably damaging Het
Fga T C 3: 83,028,618 S51P probably benign Het
Fmn1 T C 2: 113,693,094 F1141L possibly damaging Het
Foxm1 C T 6: 128,373,874 L713F probably damaging Het
Galnt4 A G 10: 99,108,674 E87G probably benign Het
Gamt T C 10: 80,260,858 D15G probably benign Het
Gm13101 T C 4: 143,964,953 N400S probably benign Het
Gm15557 C A 2: 155,942,254 D154E possibly damaging Het
Gnptab A G 10: 88,445,763 I1211V probably benign Het
Greb1 A T 12: 16,711,774 M535K probably damaging Het
Grm8 C A 6: 27,363,309 A736S possibly damaging Het
Hspa14 T C 2: 3,491,608 I373M probably benign Het
Ifi207 T A 1: 173,730,063 T370S unknown Het
Igf1r A G 7: 68,003,837 N41S probably damaging Het
Ikzf5 A T 7: 131,391,767 V224D probably damaging Het
Il10 C A 1: 131,021,373 Y90* probably null Het
Itga4 A G 2: 79,287,032 D394G probably benign Het
Kif21a A T 15: 90,956,419 S1165T probably benign Het
Krtap14 A G 16: 88,825,627 S155P probably damaging Het
Loxl2 A G 14: 69,693,097 N770S probably benign Het
Man2b1 A G 8: 85,086,845 D222G probably damaging Het
Meis3 T A 7: 16,177,571 Y64* probably null Het
Mfsd6 T A 1: 52,709,557 I50F probably benign Het
Micu2 T C 14: 57,945,397 T165A probably damaging Het
Mtcl1 T C 17: 66,379,148 E921G probably damaging Het
Muc5b A T 7: 141,843,234 N215Y unknown Het
Muc6 A G 7: 141,647,909 F772L possibly damaging Het
Myt1 A G 2: 181,797,111 D142G probably benign Het
Nol6 C T 4: 41,120,281 V479I probably benign Het
Nsun7 A G 5: 66,284,229 K414E probably benign Het
Nup210l A C 3: 90,170,562 I914L probably benign Het
Obox3 G A 7: 15,626,950 P88L probably benign Het
Olfr1098 C T 2: 86,922,578 probably null Het
Olfr1122 A G 2: 87,388,518 Y271C probably damaging Het
Olfr1132 T C 2: 87,635,670 T26A probably benign Het
Olfr1289 T C 2: 111,484,006 L192P probably damaging Het
Pclo T C 5: 14,680,427 probably benign Het
Pcsk5 T C 19: 17,568,324 N745D probably damaging Het
Pdzrn3 T A 6: 101,151,512 N731I possibly damaging Het
Rell1 T A 5: 63,936,085 D109V probably damaging Het
Rplp0 C T 5: 115,563,344 T285I probably damaging Het
Sema3g C T 14: 31,228,045 R728C probably damaging Het
Slc15a2 A G 16: 36,753,791 Y536H probably damaging Het
Slc26a5 T A 5: 21,816,964 Y488F probably benign Het
Slc5a4a A T 10: 76,186,528 S566C probably damaging Het
Spink7 C T 18: 62,596,204 E21K possibly damaging Het
Src C T 2: 157,457,187 Q35* probably null Het
Srrm2 T A 17: 23,820,796 V2234E probably damaging Het
Stk36 A T 1: 74,611,155 Q282L probably benign Het
Tas2r118 T G 6: 23,969,171 E297A probably damaging Het
Terf1 A G 1: 15,842,970 Y385C probably damaging Het
Tmc3 T C 7: 83,598,290 S198P probably damaging Het
Tmprss11b C T 5: 86,660,496 R407H possibly damaging Het
Tspyl4 G A 10: 34,298,111 E200K probably damaging Het
Ttc21a T C 9: 119,942,641 Y169H probably damaging Het
Ugt2b36 C T 5: 87,092,071 D152N probably damaging Het
Unk T C 11: 116,049,409 I196T probably benign Het
Uroc1 T G 6: 90,344,171 V243G probably damaging Het
Usp34 C A 11: 23,488,862 Q3475K probably benign Het
Vmn2r117 T A 17: 23,478,473 I82L probably benign Het
Vmn2r44 A T 7: 8,377,883 V337E probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp362 T C 4: 128,787,200 T111A probably benign Het
Zfp598 T C 17: 24,680,072 V615A probably benign Het
Other mutations in Pkdrej
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Pkdrej APN 15 85817226 missense probably damaging 1.00
IGL00981:Pkdrej APN 15 85819656 missense probably damaging 1.00
IGL01066:Pkdrej APN 15 85816159 missense probably benign 0.22
IGL01461:Pkdrej APN 15 85820374 missense possibly damaging 0.77
IGL01514:Pkdrej APN 15 85818063 missense possibly damaging 0.82
IGL01606:Pkdrej APN 15 85817700 missense possibly damaging 0.67
IGL01836:Pkdrej APN 15 85820958 missense probably damaging 1.00
IGL02089:Pkdrej APN 15 85816288 missense possibly damaging 0.87
IGL02197:Pkdrej APN 15 85815793 missense possibly damaging 0.89
IGL02331:Pkdrej APN 15 85821327 missense probably damaging 1.00
IGL02559:Pkdrej APN 15 85817848 missense probably benign
IGL02708:Pkdrej APN 15 85820787 missense probably damaging 1.00
IGL02739:Pkdrej APN 15 85819694 missense probably benign 0.41
IGL02741:Pkdrej APN 15 85817430 missense probably benign 0.04
IGL02882:Pkdrej APN 15 85817296 missense probably damaging 1.00
IGL02968:Pkdrej APN 15 85816181 nonsense probably null
IGL03250:Pkdrej APN 15 85821355 missense possibly damaging 0.92
FR4548:Pkdrej UTSW 15 85819680 small insertion probably benign
FR4737:Pkdrej UTSW 15 85819680 small insertion probably benign
PIT1430001:Pkdrej UTSW 15 85821292 missense probably damaging 0.99
R0004:Pkdrej UTSW 15 85818183 missense probably damaging 1.00
R0116:Pkdrej UTSW 15 85817545 nonsense probably null
R0117:Pkdrej UTSW 15 85816099 unclassified probably null
R0137:Pkdrej UTSW 15 85821567 missense possibly damaging 0.95
R0141:Pkdrej UTSW 15 85815630 missense probably damaging 0.99
R0325:Pkdrej UTSW 15 85819551 missense probably benign 0.08
R0714:Pkdrej UTSW 15 85815511 missense possibly damaging 0.85
R0749:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0750:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0755:Pkdrej UTSW 15 85816135 missense probably benign 0.00
R0938:Pkdrej UTSW 15 85818163 missense probably damaging 1.00
R1126:Pkdrej UTSW 15 85816314 missense probably damaging 0.99
R1204:Pkdrej UTSW 15 85818312 missense probably damaging 1.00
R1353:Pkdrej UTSW 15 85818918 missense probably damaging 1.00
R1510:Pkdrej UTSW 15 85816762 missense possibly damaging 0.61
R1573:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R1588:Pkdrej UTSW 15 85817241 missense probably benign 0.44
R1739:Pkdrej UTSW 15 85820427 missense probably benign 0.03
R1779:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1781:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1828:Pkdrej UTSW 15 85819282 missense possibly damaging 0.48
R1865:Pkdrej UTSW 15 85820324 nonsense probably null
R1870:Pkdrej UTSW 15 85816431 missense probably damaging 1.00
R1937:Pkdrej UTSW 15 85819167 missense probably benign 0.00
R2069:Pkdrej UTSW 15 85821231 missense probably benign 0.01
R2113:Pkdrej UTSW 15 85818984 missense probably damaging 1.00
R2135:Pkdrej UTSW 15 85816506 missense probably damaging 1.00
R2428:Pkdrej UTSW 15 85817572 nonsense probably null
R2991:Pkdrej UTSW 15 85819936 missense probably benign 0.00
R3029:Pkdrej UTSW 15 85817004 missense probably benign 0.16
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3747:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3748:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3749:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R4028:Pkdrej UTSW 15 85817492 missense probably benign 0.02
R4169:Pkdrej UTSW 15 85816314 missense probably benign 0.24
R4241:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4242:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4705:Pkdrej UTSW 15 85821167 nonsense probably null
R4939:Pkdrej UTSW 15 85820283 missense possibly damaging 0.82
R4954:Pkdrej UTSW 15 85816401 missense probably damaging 0.99
R4974:Pkdrej UTSW 15 85820409 missense probably benign 0.00
R4982:Pkdrej UTSW 15 85818996 missense probably damaging 0.99
R5105:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R5270:Pkdrej UTSW 15 85818327 missense probably damaging 1.00
R5296:Pkdrej UTSW 15 85817118 missense possibly damaging 0.67
R5631:Pkdrej UTSW 15 85820437 missense probably benign
R5909:Pkdrej UTSW 15 85818296 missense possibly damaging 0.82
R5998:Pkdrej UTSW 15 85815453 missense probably benign 0.01
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6125:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R6270:Pkdrej UTSW 15 85821105 nonsense probably null
R6500:Pkdrej UTSW 15 85819546 missense probably damaging 0.98
R6776:Pkdrej UTSW 15 85817309 nonsense probably null
R6786:Pkdrej UTSW 15 85818649 missense probably benign
R6866:Pkdrej UTSW 15 85820881 missense probably damaging 1.00
R6954:Pkdrej UTSW 15 85817853 nonsense probably null
R7086:Pkdrej UTSW 15 85820116 missense not run
Predicted Primers PCR Primer
(F):5'- TGAAGTGAGTCACGAGGTAGCTCAG -3'
(R):5'- ACCAAGAAGCCAGTGAAGGTGTCC -3'

Sequencing Primer
(F):5'- GCTCAGGAACAAGAAGGACCTC -3'
(R):5'- TGACTTACGGCTATGCCAAG -3'
Posted On2014-03-28