Incidental Mutation 'R1472:1110002E22Rik'
List |< first << previous [record 98 of 386652] next >> last >|
ID164974
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene NameRIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission 039525-MU
Accession Numbers
Stock #R1472 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location138065052-138081506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 138067552 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 834 (T834M)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163080]
Predicted Effect possibly damaging
Transcript: ENSMUST00000163080
AA Change: T834M

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: T834M

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik A G 1: 158,969,738 S41P probably benign Het
4933433C11Rik A T 2: 25,213,184 probably benign Het
Adamts3 A G 5: 89,684,299 probably benign Het
AI427809 A T 4: 53,262,222 F389L noncoding transcript Het
Ak1 T C 2: 32,630,301 L53P probably damaging Het
Als2cr11 A T 1: 59,067,785 S294T possibly damaging Het
Ankrd24 A G 10: 81,634,920 D61G probably damaging Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Atp13a3 C A 16: 30,351,423 probably benign Het
Atp8a1 A T 5: 67,622,706 probably benign Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atp9b A T 18: 80,917,696 probably benign Het
BC021891 T C 8: 125,941,678 S668P probably benign Het
Bmp10 A G 6: 87,433,797 I191V probably benign Het
C4b T A 17: 34,743,769 K20* probably null Het
Caps2 C T 10: 112,179,472 T139I probably benign Het
Carm1 C A 9: 21,587,843 probably benign Het
Ccar1 A G 10: 62,764,547 probably benign Het
Cdc25a T C 9: 109,876,089 S34P probably benign Het
Cdk12 T C 11: 98,211,247 probably benign Het
Cenpv T C 11: 62,536,295 I146V probably benign Het
Cep57 A T 9: 13,821,554 F59I probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Cntrl T C 2: 35,169,317 probably null Het
Coq3 T C 4: 21,899,051 probably benign Het
Cpd A G 11: 76,784,398 V1299A probably damaging Het
Cpne6 T C 14: 55,514,635 V283A probably benign Het
Crot A G 5: 8,966,941 C584R probably damaging Het
Ctsc A C 7: 88,281,462 H82P possibly damaging Het
Ddx46 G A 13: 55,638,022 probably benign Het
Dido1 T C 2: 180,660,720 N1797S probably benign Het
Dlgap4 C T 2: 156,760,901 Q855* probably null Het
Dnah3 T C 7: 120,070,958 D712G probably benign Het
Dnmt1 T C 9: 20,932,176 E256G probably benign Het
Edc4 T A 8: 105,892,828 M1396K probably damaging Het
Fam186a T C 15: 99,939,789 probably benign Het
Gmpr A G 13: 45,539,081 probably benign Het
Gnb2 C T 5: 137,531,593 probably benign Het
Grik3 G A 4: 125,704,564 probably benign Het
H1foo G T 6: 115,948,596 probably benign Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Hsd3b6 A T 3: 98,807,939 probably null Het
Itga4 T C 2: 79,272,983 probably benign Het
Itpr3 T A 17: 27,114,225 I1937N probably benign Het
Kcnk15 C A 2: 163,858,207 T122K probably damaging Het
Kifc3 A G 8: 95,137,913 probably null Het
Lama3 T A 18: 12,482,045 F1342Y probably benign Het
Lilra6 A T 7: 3,912,719 M301K possibly damaging Het
Mcpt8 T C 14: 56,082,334 T220A probably benign Het
Mettl13 C T 1: 162,537,167 V548I possibly damaging Het
Mrfap1 A G 5: 36,796,473 S41P possibly damaging Het
Mroh2b A G 15: 4,948,655 I1302V probably benign Het
Mrpl45 C T 11: 97,323,855 R123* probably null Het
Mstn T A 1: 53,061,998 I78K probably damaging Het
Mtdh T C 15: 34,114,045 S168P possibly damaging Het
Muc15 G T 2: 110,731,560 V114F probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Myocd G T 11: 65,187,504 H488Q probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nav3 T C 10: 109,727,941 E1627G probably damaging Het
Nlrp14 T C 7: 107,182,703 L369P probably benign Het
Nlrp6 A G 7: 140,923,495 T505A probably damaging Het
Npbwr1 T C 1: 5,916,681 S205G probably damaging Het
Nsmaf G A 4: 6,423,448 R307* probably null Het
Olfr1505 T C 19: 13,919,844 S275P probably damaging Het
Olfr187 A T 16: 59,036,557 L60Q probably damaging Het
Parp9 T G 16: 35,953,680 S341A possibly damaging Het
Pdss2 A G 10: 43,413,537 N346S probably benign Het
Pikfyve T A 1: 65,224,201 F503Y probably damaging Het
Polr1e G T 4: 45,028,026 A290S probably damaging Het
Ppp1r21 A T 17: 88,558,605 H305L probably damaging Het
Prss47 A G 13: 65,049,289 L139P probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rcn2 C T 9: 56,056,253 P222L probably benign Het
Rnf144b T C 13: 47,242,885 Y233H probably damaging Het
Rnf17 T C 14: 56,427,979 L196P probably damaging Het
RP24-170A20.3 A G 10: 39,891,864 M411T probably benign Het
Sfmbt1 T C 14: 30,811,384 probably benign Het
Sik2 A G 9: 51,008,811 I22T probably damaging Het
Sis A G 3: 72,889,027 V1807A probably benign Het
Slc1a2 T A 2: 102,737,909 I97N probably damaging Het
Slc22a22 A G 15: 57,247,520 F437S probably benign Het
Slc39a13 A T 2: 91,068,705 C20* probably null Het
Sos2 C T 12: 69,585,316 R1270Q probably damaging Het
Sst A G 16: 23,890,698 V16A probably benign Het
Stab1 C T 14: 31,141,586 G2073D probably benign Het
Steap3 T C 1: 120,241,426 probably benign Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sugct A T 13: 17,452,546 C241S probably benign Het
Svil T A 18: 5,048,950 C76S probably benign Het
Tcaf1 A G 6: 42,686,448 V166A possibly damaging Het
Tmem131 A T 1: 36,816,241 N801K possibly damaging Het
Tmprss2 G A 16: 97,568,890 probably benign Het
Tox3 T C 8: 90,254,345 N278S probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trpm2 C A 10: 77,966,007 V75L probably damaging Het
Tshz1 A C 18: 84,013,805 L826R possibly damaging Het
Ttn C T 2: 76,766,852 V19906I probably damaging Het
Wnt5a C T 14: 28,518,504 R204* probably null Het
Wnt5b G A 6: 119,433,481 R346C probably damaging Het
Zbtb6 T C 2: 37,429,344 T191A probably benign Het
Zc3h4 A G 7: 16,434,770 N1010D unknown Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zfp110 T C 7: 12,848,541 V372A possibly damaging Het
Zmym2 C T 14: 56,911,183 S318L probably benign Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion unknown
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCTGAGAGTAGCAAGCCTGCC -3'
(R):5'- ACTCCGAAGGAAGATGCCCTTCAC -3'

Sequencing Primer
(F):5'- CTGCCTCCCGTAGTGATG -3'
(R):5'- CCATCGGAGACATTTTGGC -3'
Posted OnMar 28, 2014