Incidental Mutation 'R1472:Dnmt1'
ID165006
Institutional Source Beutler Lab
Gene Symbol Dnmt1
Ensembl Gene ENSMUSG00000004099
Gene NameDNA methyltransferase (cytosine-5) 1
SynonymsMTase, Dnmt1o, Cxxc9, MommeD2
MMRRC Submission 039525-MU
Accession Numbers

Genbank: NM_010066

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1472 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location20907209-20959888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20932176 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 138 (E138G)
Ref Sequence ENSEMBL: ENSMUSP00000150433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004202] [ENSMUST00000177754] [ENSMUST00000178110] [ENSMUST00000216540]
Predicted Effect probably benign
Transcript: ENSMUST00000004202
AA Change: E256G

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000004202
Gene: ENSMUSG00000004099
AA Change: E256G

DomainStartEndE-ValueType
DMAP_binding 16 106 1.7e-13 SMART
low complexity region 121 143 N/A INTRINSIC
low complexity region 156 166 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
low complexity region 306 328 N/A INTRINSIC
Pfam:DNMT1-RFD 405 540 4.8e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Pfam:zf-CXXC 648 694 2.7e-17 PFAM
low complexity region 701 711 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
BAH 758 884 4.62e-31 SMART
BAH 935 1103 1.79e-37 SMART
low complexity region 1110 1124 N/A INTRINSIC
Pfam:DNA_methylase 1142 1596 1.3e-49 PFAM
low complexity region 1600 1619 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177754
AA Change: E137G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000136982
Gene: ENSMUSG00000004099
AA Change: E137G

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 154 171 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
Pfam:DNMT1-RFD 286 421 3.4e-40 PFAM
low complexity region 491 506 N/A INTRINSIC
Pfam:zf-CXXC 529 575 2.3e-17 PFAM
low complexity region 582 592 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
BAH 639 765 4.62e-31 SMART
BAH 816 984 1.79e-37 SMART
low complexity region 991 1005 N/A INTRINSIC
Pfam:DNA_methylase 1023 1477 1.3e-49 PFAM
low complexity region 1481 1500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178110
AA Change: E137G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000136669
Gene: ENSMUSG00000004099
AA Change: E137G

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
low complexity region 38 48 N/A INTRINSIC
low complexity region 62 76 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
Pfam:DNMT1-RFD 287 422 2.6e-40 PFAM
low complexity region 492 507 N/A INTRINSIC
Pfam:zf-CXXC 530 576 4.7e-17 PFAM
low complexity region 583 593 N/A INTRINSIC
low complexity region 601 613 N/A INTRINSIC
BAH 640 766 4.62e-31 SMART
BAH 817 985 1.79e-37 SMART
low complexity region 992 1006 N/A INTRINSIC
Pfam:DNA_methylase 1024 1478 8e-50 PFAM
low complexity region 1482 1501 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216135
Predicted Effect probably benign
Transcript: ENSMUST00000216540
AA Change: E138G

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a methyltransferase that preferentially methylates cytosines of CpG residues in hemimethylated DNA to generate fully methylated CpG base pairs during DNA replication. This enzyme plays roles in diverse cellular processes including cell cycle regulation, DNA repair, and telomere maintenance. The encoded protein is composed of an N-terminal domain with a nuclear localization sequence and replication fork-targeting domain, a DNA-binding CXXC domain, two bromo-adjacent homology domains, and a C-terminal catalytic domain. Mouse embryonic stem cells mutant for this gene are viable, but when introduced into the germ line, cause a recessive lethal phenotype with mutant embryos displaying stunted growth and developmental defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations causing partial or severe loss of function were homozygous lethal by embryonic day 9.5, with lack of appropriate genomic imprinting observed at several loci. [provided by MGI curators]
Allele List at MGI

All alleles(109) : Targeted, knock-out(5) Targeted, other(11) Gene trapped(92) Chemically induced(1)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,067,552 T834M possibly damaging Het
Ak1 T C 2: 32,630,301 L32P probably damaging Het
Ankrd24 A G 10: 81,634,920 D61G probably damaging Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Bmp10 A G 6: 87,433,797 I191V probably benign Het
C2cd6 A T 1: 59,067,785 S294T possibly damaging Het
C4b T A 17: 34,743,769 K20* probably null Het
Caps2 C T 10: 112,179,472 T139I probably benign Het
Cdc25a T C 9: 109,876,089 S34P probably benign Het
Cenpv T C 11: 62,536,295 I146V probably benign Het
Cep57 A T 9: 13,821,554 F32I probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Cntrl T C 2: 35,169,317 probably null Het
Cpd A G 11: 76,784,398 V1299A probably damaging Het
Cpne6 T C 14: 55,514,635 V283A probably benign Het
Crot A G 5: 8,966,941 C584R probably damaging Het
Ctsc A C 7: 88,281,462 H83P possibly damaging Het
Dido1 T C 2: 180,660,720 N1797S probably benign Het
Dlgap4 C T 2: 156,760,901 Q148* probably null Het
Dnah3 T C 7: 120,070,958 D688G probably benign Het
Edc4 T A 8: 105,892,828 M1396K probably damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Hsd3b6 A T 3: 98,807,939 probably null Het
Itpr3 T A 17: 27,114,225 I1937N probably benign Het
Kcnk15 C A 2: 163,858,207 T103K probably damaging Het
Kifc3 A G 8: 95,137,913 probably null Het
Lama3 T A 18: 12,482,045 F1342Y probably benign Het
Lilra6 A T 7: 3,912,719 M98K probably damaging Het
Map3k21 T C 8: 125,941,678 S668P probably benign Het
Mcpt8 T C 14: 56,082,334 T220A probably benign Het
Mettl13 C T 1: 162,537,167 V548I possibly damaging Het
Mfsd4b4 A G 10: 39,891,864 M411T probably benign Het
Mrfap1 A G 5: 36,796,473 S41P possibly damaging Het
Mroh2b A G 15: 4,948,655 I1302V probably benign Het
Mrpl45 C T 11: 97,323,855 R123* probably null Het
Mstn T A 1: 53,061,998 I78K probably damaging Het
Mtdh T C 15: 34,114,045 S168P possibly damaging Het
Muc15 G T 2: 110,731,560 V114F probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Myocd G T 11: 65,187,504 H360Q probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nav3 T C 10: 109,727,941 E1627G probably damaging Het
Nlrp14 T C 7: 107,182,703 L369P probably benign Het
Nlrp6 A G 7: 140,923,495 T505A probably damaging Het
Npbwr1 T C 1: 5,916,681 S205G probably damaging Het
Nsmaf G A 4: 6,423,448 R307* probably null Het
Olfr1505 T C 19: 13,919,844 S275P probably damaging Het
Olfr187 A T 16: 59,036,557 L60Q probably damaging Het
Parp9 T G 16: 35,953,680 S341A possibly damaging Het
Pdss2 A G 10: 43,413,537 N346S probably benign Het
Pikfyve T A 1: 65,224,201 F503Y probably damaging Het
Polr1e G T 4: 45,028,026 A290S probably damaging Het
Ppp1r21 A T 17: 88,558,605 H305L probably damaging Het
Prss47 A G 13: 65,049,289 L117P probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rcn2 C T 9: 56,056,253 P222L probably benign Het
Rnf144b T C 13: 47,242,885 Y233H probably damaging Het
Rnf17 T C 14: 56,427,979 L196P probably damaging Het
Sik2 A G 9: 51,008,811 I22T probably damaging Het
Sis A G 3: 72,889,027 V1807A probably benign Het
Slc1a2 T A 2: 102,737,909 I88N probably damaging Het
Slc22a22 A G 15: 57,247,520 F437S probably benign Het
Slc39a13 A T 2: 91,068,705 C20* probably null Het
Sos2 C T 12: 69,585,316 probably null Het
Sst A G 16: 23,890,698 V16A probably benign Het
Stab1 C T 14: 31,141,586 G2073D probably benign Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sugct A T 13: 17,452,546 C241S probably benign Het
Svil T A 18: 5,048,950 C76S probably benign Het
Tcaf1 A G 6: 42,686,448 V166A possibly damaging Het
Tmem131 A T 1: 36,816,241 N801K possibly damaging Het
Tox3 T C 8: 90,254,345 N277S probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trpm2 C A 10: 77,966,007 V75L probably damaging Het
Tshz1 A C 18: 84,013,805 L826R possibly damaging Het
Ttn C T 2: 76,766,852 V19906I probably damaging Het
Wnt5a C T 14: 28,518,504 R184* probably null Het
Wnt5b G A 6: 119,433,481 R333C probably damaging Het
Zbtb6 T C 2: 37,429,344 T191A probably benign Het
Zc3h4 A G 7: 16,434,770 N935D unknown Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zfp110 T C 7: 12,848,541 V372A possibly damaging Het
Zmym2 C T 14: 56,911,183 S318L probably benign Het
Other mutations in Dnmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dnmt1 APN 9 20910270 missense possibly damaging 0.94
IGL01093:Dnmt1 APN 9 20909785 missense possibly damaging 0.88
IGL01160:Dnmt1 APN 9 20917319 missense possibly damaging 0.90
IGL01704:Dnmt1 APN 9 20910180 missense probably damaging 1.00
IGL02105:Dnmt1 APN 9 20907882 missense unknown
IGL02124:Dnmt1 APN 9 20908549 missense probably damaging 1.00
IGL02188:Dnmt1 APN 9 20941738 nonsense probably null
IGL02409:Dnmt1 APN 9 20926497 missense probably benign 0.00
IGL02579:Dnmt1 APN 9 20918120 missense possibly damaging 0.79
IGL02625:Dnmt1 APN 9 20927146 missense probably benign 0.01
IGL02794:Dnmt1 APN 9 20936551 missense probably benign
IGL02795:Dnmt1 APN 9 20927111 missense probably benign 0.12
IGL02938:Dnmt1 APN 9 20941373 missense probably benign 0.23
IGL03245:Dnmt1 APN 9 20915760 missense probably damaging 0.99
IGL03303:Dnmt1 APN 9 20926710 missense probably benign
B5639:Dnmt1 UTSW 9 20907968 splice site probably benign
R0071:Dnmt1 UTSW 9 20908620 missense probably damaging 0.99
R0180:Dnmt1 UTSW 9 20908620 missense probably damaging 0.99
R0368:Dnmt1 UTSW 9 20941757 missense probably damaging 0.99
R0387:Dnmt1 UTSW 9 20918213 missense probably damaging 1.00
R0529:Dnmt1 UTSW 9 20911550 missense probably damaging 1.00
R0532:Dnmt1 UTSW 9 20918556 splice site probably benign
R0612:Dnmt1 UTSW 9 20918193 missense probably damaging 0.98
R1109:Dnmt1 UTSW 9 20922388 missense probably damaging 1.00
R1298:Dnmt1 UTSW 9 20941456 missense probably benign
R1345:Dnmt1 UTSW 9 20908518 missense probably damaging 1.00
R1654:Dnmt1 UTSW 9 20936574 missense possibly damaging 0.75
R1817:Dnmt1 UTSW 9 20927126 missense probably benign
R1836:Dnmt1 UTSW 9 20918246 missense probably damaging 1.00
R1957:Dnmt1 UTSW 9 20927146 missense probably benign 0.01
R1958:Dnmt1 UTSW 9 20927146 missense probably benign 0.01
R2097:Dnmt1 UTSW 9 20909788 missense probably benign 0.00
R2145:Dnmt1 UTSW 9 20937155 splice site probably benign
R2326:Dnmt1 UTSW 9 20924146 splice site probably benign
R4199:Dnmt1 UTSW 9 20938118 missense probably benign 0.00
R4456:Dnmt1 UTSW 9 20909842 missense probably damaging 1.00
R4518:Dnmt1 UTSW 9 20911978 missense probably benign 0.00
R4586:Dnmt1 UTSW 9 20926693 missense probably benign 0.05
R4836:Dnmt1 UTSW 9 20908558 missense probably damaging 1.00
R5014:Dnmt1 UTSW 9 20912254 missense probably benign 0.07
R5338:Dnmt1 UTSW 9 20952719 missense probably benign 0.44
R5385:Dnmt1 UTSW 9 20918480 missense probably damaging 1.00
R5579:Dnmt1 UTSW 9 20920205 missense probably damaging 1.00
R5645:Dnmt1 UTSW 9 20922147 missense probably damaging 1.00
R5719:Dnmt1 UTSW 9 20912595 missense possibly damaging 0.86
R5881:Dnmt1 UTSW 9 20952717 missense probably damaging 0.97
R6039:Dnmt1 UTSW 9 20926420 intron probably benign
R6039:Dnmt1 UTSW 9 20926420 intron probably benign
R6143:Dnmt1 UTSW 9 20927134 missense probably benign 0.30
R6342:Dnmt1 UTSW 9 20909793 nonsense probably null
R6374:Dnmt1 UTSW 9 20924045 missense possibly damaging 0.73
R6953:Dnmt1 UTSW 9 20918526 missense probably benign
R6990:Dnmt1 UTSW 9 20915814 nonsense probably null
R7089:Dnmt1 UTSW 9 20908489 missense not run
X0026:Dnmt1 UTSW 9 20913914 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGCTGAATTGACAGGCTCCAAC -3'
(R):5'- TGAGCCCCAGTTCTGCAAAATGC -3'

Sequencing Primer
(F):5'- ACAGGCTCCAACGTGCAG -3'
(R):5'- GCCCAGAGCATTGATGATCA -3'
Posted On2014-03-28