Incidental Mutation 'R1145:Vwa3a'
ID165071
Institutional Source Beutler Lab
Gene Symbol Vwa3a
Ensembl Gene ENSMUSG00000030889
Gene Namevon Willebrand factor A domain containing 3A
SynonymsE030013G06Rik
MMRRC Submission 039218-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R1145 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location120739318-120805742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120793343 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 802 (Y802H)
Ref Sequence ENSEMBL: ENSMUSP00000133029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033180] [ENSMUST00000165055] [ENSMUST00000166668] [ENSMUST00000167213] [ENSMUST00000168430] [ENSMUST00000168600]
Predicted Effect probably damaging
Transcript: ENSMUST00000033180
AA Change: Y802H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033180
Gene: ENSMUSG00000030889
AA Change: Y802H

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 6.3e-30 PFAM
Pfam:VWA_3 483 634 1.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165055
SMART Domains Protein: ENSMUSP00000129672
Gene: ENSMUSG00000030889

DomainStartEndE-ValueType
Blast:VWA 1 162 1e-94 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000166083
Predicted Effect probably damaging
Transcript: ENSMUST00000166668
AA Change: Y802H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129136
Gene: ENSMUSG00000030889
AA Change: Y802H

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 1.3e-28 PFAM
Pfam:VWA_3 483 633 5.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167213
AA Change: Y802H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133029
Gene: ENSMUSG00000030889
AA Change: Y802H

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 1.3e-28 PFAM
Pfam:VWA_3 483 633 5.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168430
Predicted Effect probably benign
Transcript: ENSMUST00000168600
SMART Domains Protein: ENSMUSP00000132372
Gene: ENSMUSG00000030889

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 8.3e-29 PFAM
Pfam:VWA_3 483 609 5.3e-17 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 88.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,668,276 S1257P possibly damaging Het
AC159637.1 C T 12: 93,928,280 noncoding transcript Het
Agk T C 6: 40,352,438 probably benign Het
Arhgef5 C A 6: 43,273,088 Q258K possibly damaging Het
Armc4 G T 18: 7,268,436 P361Q probably damaging Het
C1s1 C A 6: 124,540,800 D74Y probably damaging Het
Cpxm2 A G 7: 132,057,648 S497P probably damaging Het
Ctsj C T 13: 61,002,543 S214N probably damaging Het
Dnali1 T C 4: 125,065,547 S18G possibly damaging Het
Eif4g3 C T 4: 138,165,818 T959M probably damaging Het
Eml6 A G 11: 29,777,430 F1231L probably benign Het
Glp1r T C 17: 30,919,432 V160A probably benign Het
Gm11143 T G 6: 69,617,408 V60G unknown Het
Hmcn1 A T 1: 150,679,607 probably null Het
Inpp5k T C 11: 75,633,459 probably benign Het
Krtdap A T 7: 30,789,550 probably benign Het
Ldb2 A G 5: 44,532,674 L201P probably damaging Het
Loxl4 A T 19: 42,608,555 probably benign Het
Otud6b T A 4: 14,812,532 T272S probably benign Het
Pnpla2 T C 7: 141,455,416 Y44H probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Sel1l3 C T 5: 53,131,827 R884H probably damaging Het
Slc43a2 T A 11: 75,566,989 Y363* probably null Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Tap2 C A 17: 34,215,940 D652E possibly damaging Het
Unc80 T C 1: 66,472,088 V85A probably damaging Het
Zc3h4 G A 7: 16,416,913 R60Q possibly damaging Het
Zfp385a A T 15: 103,317,943 probably benign Het
Other mutations in Vwa3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Vwa3a APN 7 120783974 missense probably benign 0.09
IGL01807:Vwa3a APN 7 120775506 splice site probably null
IGL02850:Vwa3a APN 7 120773292 missense probably benign 0.00
IGL03253:Vwa3a APN 7 120778869 missense probably benign 0.03
R0026:Vwa3a UTSW 7 120780211 missense probably damaging 1.00
R0114:Vwa3a UTSW 7 120775380 missense probably benign 0.06
R1145:Vwa3a UTSW 7 120793343 missense probably damaging 0.99
R1306:Vwa3a UTSW 7 120800390 missense possibly damaging 0.49
R1355:Vwa3a UTSW 7 120784111 missense probably damaging 1.00
R1412:Vwa3a UTSW 7 120780154 missense probably damaging 1.00
R1466:Vwa3a UTSW 7 120768165 missense probably damaging 1.00
R1466:Vwa3a UTSW 7 120768165 missense probably damaging 1.00
R1584:Vwa3a UTSW 7 120768165 missense probably damaging 1.00
R1686:Vwa3a UTSW 7 120780148 missense probably damaging 1.00
R1710:Vwa3a UTSW 7 120804031 splice site probably null
R1717:Vwa3a UTSW 7 120793386 missense probably benign
R1834:Vwa3a UTSW 7 120790136 missense probably benign 0.06
R1912:Vwa3a UTSW 7 120795627 missense probably damaging 1.00
R1970:Vwa3a UTSW 7 120780171 missense probably damaging 1.00
R1978:Vwa3a UTSW 7 120758954 missense probably null 0.00
R2034:Vwa3a UTSW 7 120782645 nonsense probably null
R2059:Vwa3a UTSW 7 120758949 missense probably damaging 0.98
R2120:Vwa3a UTSW 7 120792418 missense probably benign
R2408:Vwa3a UTSW 7 120773294 missense probably benign 0.00
R3423:Vwa3a UTSW 7 120799111 missense probably damaging 1.00
R3744:Vwa3a UTSW 7 120752594 missense probably benign
R3816:Vwa3a UTSW 7 120800379 missense probably benign 0.29
R3849:Vwa3a UTSW 7 120762464 nonsense probably null
R3904:Vwa3a UTSW 7 120758876 missense probably benign
R4031:Vwa3a UTSW 7 120768232 critical splice donor site probably null
R4408:Vwa3a UTSW 7 120778926 missense probably benign 0.16
R4628:Vwa3a UTSW 7 120793375 missense probably benign 0.05
R4629:Vwa3a UTSW 7 120793375 missense probably benign 0.05
R4652:Vwa3a UTSW 7 120778915 missense probably damaging 0.96
R4884:Vwa3a UTSW 7 120791701 missense probably benign
R4948:Vwa3a UTSW 7 120776264 missense probably damaging 0.98
R5112:Vwa3a UTSW 7 120783985 missense probably damaging 1.00
R5385:Vwa3a UTSW 7 120790142 missense possibly damaging 0.91
R5386:Vwa3a UTSW 7 120790142 missense possibly damaging 0.91
R5579:Vwa3a UTSW 7 120768173 missense probably benign 0.29
R5587:Vwa3a UTSW 7 120780235 missense probably damaging 1.00
R5639:Vwa3a UTSW 7 120790143 missense probably damaging 0.99
R6102:Vwa3a UTSW 7 120776138 splice site probably null
R6239:Vwa3a UTSW 7 120794234 missense probably benign 0.00
R6279:Vwa3a UTSW 7 120782400 missense probably damaging 0.98
R6298:Vwa3a UTSW 7 120795651 missense probably benign 0.01
R6300:Vwa3a UTSW 7 120782400 missense probably damaging 0.98
R6336:Vwa3a UTSW 7 120762423 missense possibly damaging 0.93
R6907:Vwa3a UTSW 7 120792581 unclassified probably benign
V7732:Vwa3a UTSW 7 120778949 splice site probably benign
X0019:Vwa3a UTSW 7 120768209 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTGGACTCCTTGCTAAATGGAGA -3'
(R):5'- ATGCCACAGTAAGCAGGCATTCTT -3'

Sequencing Primer
(F):5'- CTCCTTGCTAAATGGAGAATGGG -3'
(R):5'- AAATGACTAAGGGGCACGTG -3'
Posted On2014-03-28