Incidental Mutation 'R1146:Iqub'
ID165103
Institutional Source Beutler Lab
Gene Symbol Iqub
Ensembl Gene ENSMUSG00000046192
Gene NameIQ motif and ubiquitin domain containing
Synonyms4932408B21Rik, Trs4
MMRRC Submission 039219-MU
Accession Numbers

Genbank: NM_172535; MGI: 3041159

Is this an essential gene? Probably non essential (E-score: 0.037) question?
Stock #R1146 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location24444865-24515067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24505628 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 94 (L94F)
Ref Sequence ENSEMBL: ENSMUSP00000051177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052277]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052277
AA Change: L94F

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051177
Gene: ENSMUSG00000046192
AA Change: L94F

DomainStartEndE-ValueType
PDB:2DAF|A 119 216 1e-38 PDB
Blast:UBQ 129 199 3e-26 BLAST
low complexity region 218 229 N/A INTRINSIC
low complexity region 289 306 N/A INTRINSIC
IQ 333 355 1.74e-1 SMART
low complexity region 357 383 N/A INTRINSIC
low complexity region 735 742 N/A INTRINSIC
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.5%
  • 10x: 95.4%
  • 20x: 88.7%
Validation Efficiency 98% (44/45)
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,531,676 V1848E probably damaging Het
Alpk3 A G 7: 81,077,595 K158E probably damaging Het
Arrdc4 T A 7: 68,740,008 E356D probably damaging Het
Asb4 A G 6: 5,423,591 N246S probably damaging Het
Ccdc150 A T 1: 54,364,971 probably benign Het
Ctsj G A 13: 61,002,498 P230L probably benign Het
Dync1i2 C T 2: 71,227,820 probably benign Het
Eme1 A G 11: 94,645,451 L564P probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Frg1 A G 8: 41,411,217 probably benign Het
Fzd2 A T 11: 102,605,380 S217C possibly damaging Het
Gaa G T 11: 119,274,904 R81L probably damaging Het
Gfral A G 9: 76,167,059 V368A probably benign Het
Gm10774 T C 2: 126,709,472 Y29C probably benign Het
Gucy1a2 T A 9: 3,759,830 N545K probably damaging Het
Herc2 T C 7: 56,146,696 S1939P probably benign Het
Ifnk T C 4: 35,152,231 I53T probably benign Het
Kpna1 C T 16: 36,033,379 R460* probably null Het
Masp1 T C 16: 23,492,115 E189G probably damaging Het
Mogat1 A G 1: 78,523,613 I105V probably benign Het
Mpi A G 9: 57,545,189 probably benign Het
Msh2 C A 17: 87,680,060 D209E probably benign Het
Nsf G A 11: 103,828,538 T646I probably damaging Het
Olfr1257 C T 2: 89,881,206 P127S probably damaging Het
Olfr1416 G A 1: 92,479,890 H244Y probably damaging Het
Olfr1449 T A 19: 12,934,965 S76T possibly damaging Het
Olfr980 A T 9: 40,006,094 V285D possibly damaging Het
Otogl T A 10: 107,886,513 I327F probably damaging Het
Pappa2 T C 1: 158,854,982 D832G probably damaging Het
Pax5 G T 4: 44,697,512 probably benign Het
Pfkfb4 A G 9: 109,007,726 E163G probably benign Het
Phc1 T C 6: 122,323,457 probably benign Het
Piwil1 T C 5: 128,747,893 S552P probably benign Het
Ppfia3 A C 7: 45,352,215 D424E probably benign Het
Prss16 A G 13: 22,006,968 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbsn A G 6: 92,201,730 probably null Het
Rexo1 C T 10: 80,544,405 S919N probably benign Het
Sec31a T C 5: 100,362,173 N1152D probably damaging Het
Sel1l3 A T 5: 53,117,103 F1012I possibly damaging Het
Sema4c A G 1: 36,550,565 V539A probably benign Het
Sf3b5 A G 10: 13,008,831 E70G possibly damaging Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tor1aip2 T C 1: 156,064,737 V263A possibly damaging Het
Unc45b A G 11: 82,922,907 E380G probably damaging Het
Usp16 C T 16: 87,474,648 T364M possibly damaging Het
Wwox T C 8: 114,712,036 S281P possibly damaging Het
Zfp110 A G 7: 12,846,794 probably null Het
Zfp335 G A 2: 164,896,123 A856V probably benign Het
Zfp652 G A 11: 95,749,782 E178K possibly damaging Het
Other mutations in Iqub
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Iqub APN 6 24501006 splice site probably benign
IGL01447:Iqub APN 6 24505628 missense probably benign 0.01
IGL01621:Iqub APN 6 24446212 missense probably benign 0.45
IGL01702:Iqub APN 6 24500313 missense probably benign 0.13
IGL01917:Iqub APN 6 24479319 missense probably damaging 0.97
IGL02411:Iqub APN 6 24449811 missense probably damaging 0.98
IGL02580:Iqub APN 6 24501399 missense probably benign 0.06
IGL02704:Iqub APN 6 24505910 splice site probably benign
IGL02901:Iqub APN 6 24454195 missense probably damaging 1.00
D4043:Iqub UTSW 6 24505751 missense possibly damaging 0.81
R0304:Iqub UTSW 6 24454291 missense probably damaging 0.99
R0391:Iqub UTSW 6 24446155 missense probably benign 0.00
R0453:Iqub UTSW 6 24450830 missense probably damaging 1.00
R0464:Iqub UTSW 6 24479263 nonsense probably null
R0465:Iqub UTSW 6 24503784 missense probably damaging 1.00
R0479:Iqub UTSW 6 24505810 missense probably benign 0.28
R0606:Iqub UTSW 6 24501261 splice site probably benign
R1146:Iqub UTSW 6 24505628 missense possibly damaging 0.89
R1238:Iqub UTSW 6 24505885 missense probably benign 0.03
R1452:Iqub UTSW 6 24491559 missense probably benign 0.13
R1927:Iqub UTSW 6 24491671 missense probably benign 0.11
R3195:Iqub UTSW 6 24462037 splice site probably benign
R4438:Iqub UTSW 6 24505868 missense probably benign 0.01
R4577:Iqub UTSW 6 24501291 missense probably damaging 0.99
R4671:Iqub UTSW 6 24479184 missense probably benign 0.00
R4860:Iqub UTSW 6 24450842 missense probably damaging 0.99
R4860:Iqub UTSW 6 24450842 missense probably damaging 0.99
R4906:Iqub UTSW 6 24501369 missense probably damaging 0.99
R5605:Iqub UTSW 6 24505621 missense probably benign
R5772:Iqub UTSW 6 24454251 missense possibly damaging 0.64
R5801:Iqub UTSW 6 24449769 missense probably benign 0.11
R5853:Iqub UTSW 6 24491602 missense probably benign 0.00
R6423:Iqub UTSW 6 24491529 missense probably damaging 0.98
R6475:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6476:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6477:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6701:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6702:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6703:Iqub UTSW 6 24449745 missense probably damaging 1.00
R6860:Iqub UTSW 6 24505738 missense possibly damaging 0.81
X0025:Iqub UTSW 6 24500384 missense probably damaging 0.96
Z1088:Iqub UTSW 6 24500243 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGGGCTCCAGTCCCACACTAAATC -3'
(R):5'- GATGAAGTGCAGGAACTCACCACC -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- TCACCACCGAGAGCGAG -3'
Posted On2014-03-28