Incidental Mutation 'R1146:Mpi'
ID165116
Institutional Source Beutler Lab
Gene Symbol Mpi
Ensembl Gene ENSMUSG00000032306
Gene Namemannose phosphate isomerase
Synonyms1110002E17Rik, Mpi-1, Mpi1
MMRRC Submission 039219-MU
Accession Numbers

Genbank: NM_025837; MGI: 97075

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1146 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location57544256-57552763 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 57545189 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000034856] [ENSMUST00000093833] [ENSMUST00000114200]
Predicted Effect probably benign
Transcript: ENSMUST00000034856
SMART Domains Protein: ENSMUSP00000034856
Gene: ENSMUSG00000032306

DomainStartEndE-ValueType
Pfam:PMI_typeI 6 384 4.3e-145 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093833
SMART Domains Protein: ENSMUSP00000091353
Gene: ENSMUSG00000032305

DomainStartEndE-ValueType
Pfam:FAM219A 72 128 4.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114200
SMART Domains Protein: ENSMUSP00000109838
Gene: ENSMUSG00000032305

DomainStartEndE-ValueType
Pfam:FAM219A 72 197 1.6e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145543
Predicted Effect probably benign
Transcript: ENSMUST00000156428
SMART Domains Protein: ENSMUSP00000119342
Gene: ENSMUSG00000032306

DomainStartEndE-ValueType
Pfam:PMI_typeI 3 119 3.1e-45 PFAM
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.5%
  • 10x: 95.4%
  • 20x: 88.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphomannose isomerase catalyzes the interconversion of fructose-6-phosphate and mannose-6-phosphate and plays a critical role in maintaining the supply of D-mannose derivatives, which are required for most glycosylation reactions. Mutations in the MPI gene were found in patients with carbohydrate-deficient glycoprotein syndrome, type Ib. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, variable abnormalities of the yolk sac and embryonic vasculature, and partial penetrance of abnormal chorioallantoic fusion, placental defects, impaired emrbyo turning, increased apoptosis, and posterior axial truncations. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,531,676 V1848E probably damaging Het
Alpk3 A G 7: 81,077,595 K158E probably damaging Het
Arrdc4 T A 7: 68,740,008 E356D probably damaging Het
Asb4 A G 6: 5,423,591 N246S probably damaging Het
Ccdc150 A T 1: 54,364,971 probably benign Het
Ctsj G A 13: 61,002,498 P230L probably benign Het
Dync1i2 C T 2: 71,227,820 probably benign Het
Eme1 A G 11: 94,645,451 L564P probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Frg1 A G 8: 41,411,217 probably benign Het
Fzd2 A T 11: 102,605,380 S217C possibly damaging Het
Gaa G T 11: 119,274,904 R81L probably damaging Het
Gfral A G 9: 76,167,059 V368A probably benign Het
Gm10774 T C 2: 126,709,472 Y29C probably benign Het
Gucy1a2 T A 9: 3,759,830 N545K probably damaging Het
Herc2 T C 7: 56,146,696 S1939P probably benign Het
Ifnk T C 4: 35,152,231 I53T probably benign Het
Iqub G A 6: 24,505,628 L94F possibly damaging Het
Kpna1 C T 16: 36,033,379 R460* probably null Het
Masp1 T C 16: 23,492,115 E189G probably damaging Het
Mogat1 A G 1: 78,523,613 I105V probably benign Het
Msh2 C A 17: 87,680,060 D209E probably benign Het
Nsf G A 11: 103,828,538 T646I probably damaging Het
Olfr1257 C T 2: 89,881,206 P127S probably damaging Het
Olfr1416 G A 1: 92,479,890 H244Y probably damaging Het
Olfr1449 T A 19: 12,934,965 S76T possibly damaging Het
Olfr980 A T 9: 40,006,094 V285D possibly damaging Het
Otogl T A 10: 107,886,513 I327F probably damaging Het
Pappa2 T C 1: 158,854,982 D832G probably damaging Het
Pax5 G T 4: 44,697,512 probably benign Het
Pfkfb4 A G 9: 109,007,726 E163G probably benign Het
Phc1 T C 6: 122,323,457 probably benign Het
Piwil1 T C 5: 128,747,893 S552P probably benign Het
Ppfia3 A C 7: 45,352,215 D424E probably benign Het
Prss16 A G 13: 22,006,968 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbsn A G 6: 92,201,730 probably null Het
Rexo1 C T 10: 80,544,405 S919N probably benign Het
Sec31a T C 5: 100,362,173 N1152D probably damaging Het
Sel1l3 A T 5: 53,117,103 F1012I possibly damaging Het
Sema4c A G 1: 36,550,565 V539A probably benign Het
Sf3b5 A G 10: 13,008,831 E70G possibly damaging Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tor1aip2 T C 1: 156,064,737 V263A possibly damaging Het
Unc45b A G 11: 82,922,907 E380G probably damaging Het
Usp16 C T 16: 87,474,648 T364M possibly damaging Het
Wwox T C 8: 114,712,036 S281P possibly damaging Het
Zfp110 A G 7: 12,846,794 probably null Het
Zfp335 G A 2: 164,896,123 A856V probably benign Het
Zfp652 G A 11: 95,749,782 E178K possibly damaging Het
Other mutations in Mpi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Mpi APN 9 57552266 missense probably damaging 1.00
IGL01071:Mpi APN 9 57550592 missense probably damaging 1.00
IGL01604:Mpi APN 9 57550742 missense possibly damaging 0.85
IGL02090:Mpi APN 9 57550653 missense probably benign 0.00
benadryl UTSW 9 57550757 missense probably damaging 1.00
zyrtec UTSW 9 57545217 missense probably damaging 1.00
F6893:Mpi UTSW 9 57546549 missense probably benign 0.12
R0751:Mpi UTSW 9 57550614 missense probably damaging 1.00
R3727:Mpi UTSW 9 57544849 missense possibly damaging 0.69
R3944:Mpi UTSW 9 57545253 missense probably damaging 1.00
R4645:Mpi UTSW 9 57550757 missense probably damaging 1.00
R4772:Mpi UTSW 9 57544898 missense probably damaging 1.00
R4856:Mpi UTSW 9 57545307 missense probably damaging 1.00
R5088:Mpi UTSW 9 57550604 missense probably damaging 0.97
R5504:Mpi UTSW 9 57545217 missense probably damaging 1.00
R5886:Mpi UTSW 9 57548462 unclassified probably benign
R7038:Mpi UTSW 9 57545217 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGGACCATCAGAAGGATGCTG -3'
(R):5'- GTGCCAACCCTGTGTGAAATGCTC -3'

Sequencing Primer
(F):5'- GAGACTTTGTATTCAGTGACAGAGC -3'
(R):5'- CCTGTGTGAAATGCTCAACTAC -3'
Posted On2014-03-28