Incidental Mutation 'R1146:Fzd2'
ID165125
Institutional Source Beutler Lab
Gene Symbol Fzd2
Ensembl Gene ENSMUSG00000050288
Gene Namefrizzled class receptor 2
SynonymsMfz10a, Fz10, Mfz10
MMRRC Submission 039219-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.529) question?
Stock #R1146 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location102604396-102608058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102605380 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 217 (S217C)
Ref Sequence ENSEMBL: ENSMUSP00000091463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057893]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057893
AA Change: S217C

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091463
Gene: ENSMUSG00000050288
AA Change: S217C

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FRI 43 160 7.47e-74 SMART
low complexity region 176 195 N/A INTRINSIC
Frizzled 239 563 3.32e-218 SMART
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.5%
  • 10x: 95.4%
  • 20x: 88.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the wingless type MMTV integration site family of signaling proteins. This gene encodes a protein that is coupled to the beta-catenin canonical signaling pathway. Competition between the wingless-type MMTV integration site family, member 3A and wingless-type MMTV integration site family, member 5A gene products for binding of this protein is thought to regulate the beta-catenin-dependent and -independent pathways. [provided by RefSeq, Dec 2010]
PHENOTYPE: About 50% of mice homozygous for a reporter allele display a cleft palate and die as neonates; the remaining 50% survive exhibiting a variable degree of postnatal runting and reduced olfactory sensitivity to various odorants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,531,676 V1848E probably damaging Het
Alpk3 A G 7: 81,077,595 K158E probably damaging Het
Arrdc4 T A 7: 68,740,008 E356D probably damaging Het
Asb4 A G 6: 5,423,591 N246S probably damaging Het
Ccdc150 A T 1: 54,364,971 probably benign Het
Ctsj G A 13: 61,002,498 P230L probably benign Het
Dync1i2 C T 2: 71,227,820 probably benign Het
Eme1 A G 11: 94,645,451 L564P probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Frg1 A G 8: 41,411,217 probably benign Het
Gaa G T 11: 119,274,904 R81L probably damaging Het
Gfral A G 9: 76,167,059 V368A probably benign Het
Gm10774 T C 2: 126,709,472 Y29C probably benign Het
Gucy1a2 T A 9: 3,759,830 N545K probably damaging Het
Herc2 T C 7: 56,146,696 S1939P probably benign Het
Ifnk T C 4: 35,152,231 I53T probably benign Het
Iqub G A 6: 24,505,628 L94F possibly damaging Het
Kpna1 C T 16: 36,033,379 R460* probably null Het
Masp1 T C 16: 23,492,115 E189G probably damaging Het
Mogat1 A G 1: 78,523,613 I105V probably benign Het
Mpi A G 9: 57,545,189 probably benign Het
Msh2 C A 17: 87,680,060 D209E probably benign Het
Nsf G A 11: 103,828,538 T646I probably damaging Het
Olfr1257 C T 2: 89,881,206 P127S probably damaging Het
Olfr1416 G A 1: 92,479,890 H244Y probably damaging Het
Olfr1449 T A 19: 12,934,965 S76T possibly damaging Het
Olfr980 A T 9: 40,006,094 V285D possibly damaging Het
Otogl T A 10: 107,886,513 I327F probably damaging Het
Pappa2 T C 1: 158,854,982 D832G probably damaging Het
Pax5 G T 4: 44,697,512 probably benign Het
Pfkfb4 A G 9: 109,007,726 E163G probably benign Het
Phc1 T C 6: 122,323,457 probably benign Het
Piwil1 T C 5: 128,747,893 S552P probably benign Het
Ppfia3 A C 7: 45,352,215 D424E probably benign Het
Prss16 A G 13: 22,006,968 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbsn A G 6: 92,201,730 probably null Het
Rexo1 C T 10: 80,544,405 S919N probably benign Het
Sec31a T C 5: 100,362,173 N1152D probably damaging Het
Sel1l3 A T 5: 53,117,103 F1012I possibly damaging Het
Sema4c A G 1: 36,550,565 V539A probably benign Het
Sf3b5 A G 10: 13,008,831 E70G possibly damaging Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tor1aip2 T C 1: 156,064,737 V263A possibly damaging Het
Unc45b A G 11: 82,922,907 E380G probably damaging Het
Usp16 C T 16: 87,474,648 T364M possibly damaging Het
Wwox T C 8: 114,712,036 S281P possibly damaging Het
Zfp110 A G 7: 12,846,794 probably null Het
Zfp335 G A 2: 164,896,123 A856V probably benign Het
Zfp652 G A 11: 95,749,782 E178K possibly damaging Het
Other mutations in Fzd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Fzd2 APN 11 102605782 missense possibly damaging 0.94
IGL02034:Fzd2 APN 11 102604904 missense probably damaging 1.00
IGL02035:Fzd2 APN 11 102606444 makesense probably null
PIT4585001:Fzd2 UTSW 11 102605747 missense probably damaging 0.99
R0201:Fzd2 UTSW 11 102606122 missense probably damaging 1.00
R1146:Fzd2 UTSW 11 102605380 missense possibly damaging 0.76
R1530:Fzd2 UTSW 11 102605308 missense probably benign 0.00
R1589:Fzd2 UTSW 11 102606328 missense probably benign 0.06
R1676:Fzd2 UTSW 11 102605881 missense probably damaging 1.00
R2057:Fzd2 UTSW 11 102605933 missense probably damaging 1.00
R2219:Fzd2 UTSW 11 102605423 missense probably benign 0.01
R2410:Fzd2 UTSW 11 102605627 missense possibly damaging 0.71
R5058:Fzd2 UTSW 11 102604807 missense probably damaging 0.99
R5296:Fzd2 UTSW 11 102606155 missense probably damaging 0.96
R5580:Fzd2 UTSW 11 102605839 missense probably damaging 0.99
R5788:Fzd2 UTSW 11 102605467 missense probably benign 0.03
R6104:Fzd2 UTSW 11 102606335 missense probably damaging 1.00
R6452:Fzd2 UTSW 11 102604985 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAAGTTCGGCTTCCAATGGCCC -3'
(R):5'- AGCGAAATCGCTGCATGTCCAC -3'

Sequencing Primer
(F):5'- GAGCATTTCCCGCGTCAC -3'
(R):5'- TCGCTGCATGTCCACTAAATAGG -3'
Posted On2014-03-28