Incidental Mutation 'R1147:Hrg'
ID165178
Institutional Source Beutler Lab
Gene Symbol Hrg
Ensembl Gene ENSMUSG00000022877
Gene Namehistidine-rich glycoprotein
SynonymsD18020, D16JH2
MMRRC Submission 039220-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R1147 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location22951072-22961656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 22961004 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 344 (C344F)
Ref Sequence ENSEMBL: ENSMUSP00000023590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023590] [ENSMUST00000232422]
Predicted Effect probably damaging
Transcript: ENSMUST00000023590
AA Change: C344F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023590
Gene: ENSMUSG00000022877
AA Change: C344F

DomainStartEndE-ValueType
CY 22 133 8.98e-4 SMART
CY 146 251 1.3e-2 SMART
low complexity region 347 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000232422
Meta Mutation Damage Score 0.0428 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display mild monocytosis, decreased bleeding time, faster clot lysis, and abnormal blood coagulation; however, wound healing is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 T C 8: 40,795,618 I255T possibly damaging Het
Aknad1 T A 3: 108,752,541 N290K possibly damaging Het
Als2cr12 A T 1: 58,669,463 Y215N probably damaging Het
Ano8 C A 8: 71,482,017 V447F probably damaging Het
Arhgef12 C T 9: 43,044,256 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l A T 3: 88,984,887 M1358L possibly damaging Het
Ccdc110 A G 8: 45,944,084 K837E possibly damaging Het
Cd19 T A 7: 126,411,045 D384V possibly damaging Het
Ces1f C T 8: 93,258,281 V473I possibly damaging Het
Chd6 C T 2: 160,990,271 E994K probably damaging Het
Col5a2 G T 1: 45,376,771 N1405K probably damaging Het
Dnah7b A G 1: 46,340,266 D3720G probably damaging Het
Dsel T C 1: 111,862,209 T199A possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Htt T C 5: 34,851,252 Y1462H probably damaging Het
Kcnh2 T A 5: 24,324,387 I784F probably damaging Het
Kifc3 T C 8: 95,137,918 T55A probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lsamp G A 16: 42,174,136 probably benign Het
Meis3 G A 7: 16,183,776 probably benign Het
Nlrp4d A T 7: 10,388,717 N73K probably benign Het
Olfr434 A T 6: 43,217,212 T100S probably damaging Het
Olfr692 G A 7: 105,369,277 R308Q probably benign Het
Oog3 A G 4: 144,158,412 F318S possibly damaging Het
Pde5a C T 3: 122,794,313 T376M probably damaging Het
Pkhd1l1 A G 15: 44,537,441 I2204V probably null Het
Ppp1r13l A G 7: 19,375,847 D731G probably damaging Het
Prob1 G A 18: 35,654,806 Q132* probably null Het
Ptk6 C T 2: 181,195,797 G443D probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,423,504 D749G probably damaging Het
Ralgapa1 A T 12: 55,702,480 D1212E probably damaging Het
Rsad1 T C 11: 94,544,140 Y290C probably damaging Het
Scamp1 A G 13: 94,224,886 probably null Het
Slc6a11 T A 6: 114,244,870 I507N possibly damaging Het
Stx18 T G 5: 38,126,923 probably benign Het
Sybu A T 15: 44,746,255 F78I probably damaging Het
Tecpr2 T G 12: 110,941,438 probably benign Het
Tox A T 4: 6,823,055 N87K possibly damaging Het
Trrap G A 5: 144,804,766 G1308R probably damaging Het
Trub2 A G 2: 29,787,632 probably benign Het
Vmn2r114 A T 17: 23,311,063 H123Q probably benign Het
Vmn2r15 T A 5: 109,293,206 Y262F probably damaging Het
Vmn2r33 C T 7: 7,554,145 E519K probably benign Het
Zfat A T 15: 68,212,583 probably benign Het
Zfp106 A T 2: 120,520,536 C1545S probably damaging Het
Other mutations in Hrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Hrg APN 16 22959159 critical splice acceptor site probably null
IGL02795:Hrg APN 16 22957553 unclassified probably benign
R0042:Hrg UTSW 16 22961136 unclassified probably benign
R0184:Hrg UTSW 16 22953771 critical splice donor site probably null
R1147:Hrg UTSW 16 22961004 missense probably damaging 0.99
R1733:Hrg UTSW 16 22951247 missense probably damaging 1.00
R1828:Hrg UTSW 16 22956103 missense probably damaging 1.00
R1919:Hrg UTSW 16 22954457 missense probably damaging 1.00
R2104:Hrg UTSW 16 22956199 missense probably benign 0.09
R2281:Hrg UTSW 16 22961309 unclassified probably benign
R2447:Hrg UTSW 16 22961148 unclassified probably benign
R3962:Hrg UTSW 16 22956075 missense possibly damaging 0.85
R3963:Hrg UTSW 16 22956075 missense possibly damaging 0.85
R4571:Hrg UTSW 16 22961222 unclassified probably benign
R4903:Hrg UTSW 16 22961151 unclassified probably benign
R4904:Hrg UTSW 16 22951250 missense probably benign 0.03
R5236:Hrg UTSW 16 22961513 unclassified probably benign
R6020:Hrg UTSW 16 22954518 missense probably damaging 1.00
R6054:Hrg UTSW 16 22953662 missense probably benign 0.05
R6207:Hrg UTSW 16 22954538 critical splice donor site probably null
R6374:Hrg UTSW 16 22960992 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATAAACTTGGATGCCCACCTCCAC -3'
(R):5'- TGGACCATAGCCCCGATGATACTG -3'

Sequencing Primer
(F):5'- TCCACCAGAAGGAAAAGATAACTCAG -3'
(R):5'- aggatggtgaccgtggg -3'
Posted On2014-03-28