Incidental Mutation 'R1148:Wnk1'
ID165199
Institutional Source Beutler Lab
Gene Symbol Wnk1
Ensembl Gene ENSMUSG00000045962
Gene NameWNK lysine deficient protein kinase 1
Synonyms6430573H23Rik, Hsn2, EG406236, Prkwnk1
MMRRC Submission 039221-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1148 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location119923969-120038672 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 119952006 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060043] [ENSMUST00000088644] [ENSMUST00000088646] [ENSMUST00000160686] [ENSMUST00000177761] [ENSMUST00000203030]
Predicted Effect probably benign
Transcript: ENSMUST00000060043
SMART Domains Protein: ENSMUSP00000063001
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 1.5e-44 PFAM
Pfam:Pkinase 221 479 4.4e-58 PFAM
Pfam:OSR1_C 500 537 2e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 734 746 N/A INTRINSIC
low complexity region 865 876 N/A INTRINSIC
low complexity region 1018 1028 N/A INTRINSIC
low complexity region 1042 1058 N/A INTRINSIC
internal_repeat_1 1136 1178 2.15e-5 PROSPERO
low complexity region 1289 1305 N/A INTRINSIC
low complexity region 1345 1357 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1398 1428 N/A INTRINSIC
low complexity region 1429 1454 N/A INTRINSIC
low complexity region 1496 1515 N/A INTRINSIC
low complexity region 1542 1556 N/A INTRINSIC
low complexity region 1586 1609 N/A INTRINSIC
low complexity region 1670 1691 N/A INTRINSIC
low complexity region 1698 1712 N/A INTRINSIC
low complexity region 1738 1764 N/A INTRINSIC
low complexity region 1882 1900 N/A INTRINSIC
coiled coil region 2065 2092 N/A INTRINSIC
low complexity region 2103 2114 N/A INTRINSIC
low complexity region 2116 2140 N/A INTRINSIC
low complexity region 2208 2232 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088644
SMART Domains Protein: ENSMUSP00000086017
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 5.5e-44 PFAM
Pfam:Pkinase 221 479 4.3e-56 PFAM
Pfam:OSR1_C 500 537 1.9e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
low complexity region 1050 1063 N/A INTRINSIC
low complexity region 1067 1076 N/A INTRINSIC
low complexity region 1146 1158 N/A INTRINSIC
low complexity region 1276 1286 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
internal_repeat_1 1394 1436 2.19e-5 PROSPERO
low complexity region 1547 1563 N/A INTRINSIC
low complexity region 1603 1615 N/A INTRINSIC
low complexity region 1637 1654 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
low complexity region 1687 1712 N/A INTRINSIC
low complexity region 1754 1773 N/A INTRINSIC
low complexity region 1800 1814 N/A INTRINSIC
low complexity region 1844 1867 N/A INTRINSIC
low complexity region 1928 1949 N/A INTRINSIC
low complexity region 1956 1970 N/A INTRINSIC
low complexity region 1996 2022 N/A INTRINSIC
low complexity region 2140 2158 N/A INTRINSIC
coiled coil region 2323 2350 N/A INTRINSIC
low complexity region 2361 2372 N/A INTRINSIC
low complexity region 2374 2398 N/A INTRINSIC
low complexity region 2466 2490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088646
SMART Domains Protein: ENSMUSP00000086019
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 1.3e-44 PFAM
Pfam:Pkinase 221 479 4e-58 PFAM
Pfam:OSR1_C 500 537 1.8e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 734 746 N/A INTRINSIC
low complexity region 864 874 N/A INTRINSIC
low complexity region 888 904 N/A INTRINSIC
internal_repeat_1 982 1024 7.56e-6 PROSPERO
low complexity region 1135 1151 N/A INTRINSIC
low complexity region 1191 1203 N/A INTRINSIC
low complexity region 1225 1242 N/A INTRINSIC
low complexity region 1244 1274 N/A INTRINSIC
low complexity region 1275 1300 N/A INTRINSIC
low complexity region 1342 1361 N/A INTRINSIC
low complexity region 1388 1402 N/A INTRINSIC
low complexity region 1432 1455 N/A INTRINSIC
low complexity region 1516 1537 N/A INTRINSIC
low complexity region 1544 1558 N/A INTRINSIC
low complexity region 1584 1610 N/A INTRINSIC
low complexity region 1700 1718 N/A INTRINSIC
coiled coil region 1883 1910 N/A INTRINSIC
low complexity region 1921 1932 N/A INTRINSIC
low complexity region 1934 1958 N/A INTRINSIC
low complexity region 2026 2050 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159397
Predicted Effect probably benign
Transcript: ENSMUST00000159785
SMART Domains Protein: ENSMUSP00000124905
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 159 169 N/A INTRINSIC
low complexity region 183 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160686
SMART Domains Protein: ENSMUSP00000137334
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 102 115 N/A INTRINSIC
low complexity region 119 128 N/A INTRINSIC
low complexity region 198 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160769
Predicted Effect probably benign
Transcript: ENSMUST00000161048
SMART Domains Protein: ENSMUSP00000125345
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
Blast:S_TKc 2 68 3e-34 BLAST
SCOP:d1phk__ 3 70 2e-7 SMART
Pfam:OSR1_C 89 126 9.5e-21 PFAM
coiled coil region 151 185 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161185
Predicted Effect probably benign
Transcript: ENSMUST00000161802
SMART Domains Protein: ENSMUSP00000124724
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162368
SMART Domains Protein: ENSMUSP00000125383
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 83 95 N/A INTRINSIC
low complexity region 142 158 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162541
SMART Domains Protein: ENSMUSP00000125193
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 63 84 N/A INTRINSIC
low complexity region 91 105 N/A INTRINSIC
low complexity region 131 157 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177761
SMART Domains Protein: ENSMUSP00000136777
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 1.7e-44 PFAM
Pfam:Pkinase 221 479 5.1e-58 PFAM
Pfam:OSR1_C 500 537 2.2e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 710 722 N/A INTRINSIC
low complexity region 828 839 N/A INTRINSIC
low complexity region 1005 1021 N/A INTRINSIC
low complexity region 1136 1149 N/A INTRINSIC
low complexity region 1153 1162 N/A INTRINSIC
low complexity region 1232 1244 N/A INTRINSIC
low complexity region 1291 1307 N/A INTRINSIC
internal_repeat_1 1385 1427 1.91e-5 PROSPERO
low complexity region 1538 1554 N/A INTRINSIC
low complexity region 1594 1606 N/A INTRINSIC
low complexity region 1628 1645 N/A INTRINSIC
low complexity region 1647 1677 N/A INTRINSIC
low complexity region 1678 1703 N/A INTRINSIC
low complexity region 1745 1764 N/A INTRINSIC
low complexity region 1791 1805 N/A INTRINSIC
low complexity region 1835 1858 N/A INTRINSIC
low complexity region 1919 1940 N/A INTRINSIC
low complexity region 1947 1961 N/A INTRINSIC
low complexity region 1987 2013 N/A INTRINSIC
low complexity region 2131 2149 N/A INTRINSIC
coiled coil region 2314 2341 N/A INTRINSIC
low complexity region 2352 2363 N/A INTRINSIC
low complexity region 2365 2389 N/A INTRINSIC
low complexity region 2457 2481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203030
SMART Domains Protein: ENSMUSP00000145304
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 4.1e-44 PFAM
Pfam:Pkinase 221 479 3.2e-56 PFAM
Pfam:OSR1_C 500 537 1.5e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 734 746 N/A INTRINSIC
low complexity region 793 809 N/A INTRINSIC
internal_repeat_1 887 929 5.8e-6 PROSPERO
low complexity region 1040 1056 N/A INTRINSIC
low complexity region 1096 1108 N/A INTRINSIC
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1149 1179 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1247 1266 N/A INTRINSIC
low complexity region 1293 1307 N/A INTRINSIC
low complexity region 1337 1360 N/A INTRINSIC
low complexity region 1421 1442 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1489 1515 N/A INTRINSIC
low complexity region 1633 1651 N/A INTRINSIC
coiled coil region 1816 1843 N/A INTRINSIC
low complexity region 1854 1865 N/A INTRINSIC
low complexity region 1867 1891 N/A INTRINSIC
low complexity region 1959 1983 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204207
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNK subfamily of serine/threonine protein kinases. The encoded protein may be a key regulator of blood pressure by controlling the transport of sodium and chloride ions. Mutations in this gene have been associated with pseudohypoaldosteronism type II and hereditary sensory neuropathy type II. Alternatively spliced transcript variants encoding different isoforms have been described but the full-length nature of all of them has yet to be determined.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutant mice die before birth, whereas heterozygotes survive and exhibit decreased blood pressure. Mice homozygous for an allele that does not produce the kidney isoform exhibit a slight increase in systemic arterial diastolic blood pressure and reduced sensitivity to amiloride. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
AC149051.1 A G 8: 63,926,855 L981P probably damaging Het
Alg10b T C 15: 90,227,865 F304S possibly damaging Het
Ank3 C T 10: 69,882,539 S540F probably damaging Het
Arhgef16 T C 4: 154,280,889 N590D probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bbs9 T C 9: 22,575,100 probably benign Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Cilp T A 9: 65,280,316 L1231Q possibly damaging Het
Coq8a G A 1: 180,169,403 probably benign Het
Cyp4x1 A G 4: 115,126,555 probably benign Het
Dars T C 1: 128,366,909 probably benign Het
Disp2 G A 2: 118,806,418 probably null Het
Dnah5 T C 15: 28,421,690 L3896P probably damaging Het
Dpp8 T C 9: 65,053,832 probably null Het
Esp4 A C 17: 40,602,371 N43T probably benign Het
Fat3 T C 9: 15,996,774 D2644G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Homo
Hexdc A G 11: 121,221,267 I438V probably benign Het
Lonp2 A G 8: 86,636,540 E262G probably benign Het
Ly6h G T 15: 75,565,172 S118R unknown Het
Mapk12 T C 15: 89,134,623 Y203C probably damaging Het
Mapk15 A G 15: 75,998,155 T375A probably benign Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr1009 C A 2: 85,722,276 Y290* probably null Het
Osbpl11 T C 16: 33,227,212 F515S probably damaging Het
Pcdh15 T C 10: 74,170,560 V90A probably damaging Het
Ptpn4 T A 1: 119,675,709 probably benign Het
Ptpn4 T C 1: 119,684,540 D41G probably damaging Het
Rbm4b A G 19: 4,757,499 H81R probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sh3d19 A G 3: 86,107,327 D475G possibly damaging Het
Shprh T C 10: 11,213,482 S1655P possibly damaging Het
Slc25a12 G A 2: 71,312,568 probably benign Het
Strc A G 2: 121,372,077 probably benign Het
Trp53rka C A 2: 165,493,041 probably benign Het
Ttc22 G A 4: 106,623,031 V161M probably damaging Het
Unc79 T C 12: 103,112,667 L1504P probably damaging Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Wsb2 T C 5: 117,370,677 probably benign Het
Other mutations in Wnk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Wnk1 APN 6 119960708 missense probably damaging 1.00
IGL01364:Wnk1 APN 6 119937411 missense probably damaging 1.00
IGL01715:Wnk1 APN 6 119948397 missense probably damaging 1.00
IGL01951:Wnk1 APN 6 119963485 missense probably damaging 0.99
IGL02043:Wnk1 APN 6 119949078 unclassified probably benign
IGL02268:Wnk1 APN 6 119937373 nonsense probably null
IGL02348:Wnk1 APN 6 119963328 missense probably damaging 0.98
IGL02425:Wnk1 APN 6 119963454 missense probably damaging 1.00
IGL02850:Wnk1 APN 6 119937862 missense probably benign 0.26
IGL03160:Wnk1 APN 6 119926633 missense probably damaging 1.00
IGL03387:Wnk1 APN 6 119954187 missense possibly damaging 0.76
IGL03405:Wnk1 APN 6 119953895 missense probably benign 0.41
Narrow UTSW 6 119992408 missense probably damaging 1.00
nictitate UTSW 6 120002280 missense possibly damaging 0.88
opportunity UTSW 6 119951068 missense probably damaging 1.00
path UTSW 6 120037149 missense probably damaging 0.99
Unforgiving UTSW 6 119948282 missense probably damaging 1.00
Window UTSW 6 119992453 missense probably damaging 1.00
woke UTSW 6 119962955 missense probably benign 0.12
IGL03052:Wnk1 UTSW 6 119944799 splice site probably benign
PIT4480001:Wnk1 UTSW 6 119963367 nonsense probably null
R0044:Wnk1 UTSW 6 120037149 missense probably damaging 0.99
R0207:Wnk1 UTSW 6 119952733 missense probably damaging 1.00
R0333:Wnk1 UTSW 6 119928163 intron probably benign
R0453:Wnk1 UTSW 6 119963151 missense probably damaging 0.99
R0457:Wnk1 UTSW 6 119969332 missense probably damaging 1.00
R0501:Wnk1 UTSW 6 119962803 missense probably damaging 1.00
R0525:Wnk1 UTSW 6 119926564 missense probably damaging 1.00
R0526:Wnk1 UTSW 6 119951992 missense probably damaging 0.99
R0606:Wnk1 UTSW 6 119926683 missense probably damaging 1.00
R0658:Wnk1 UTSW 6 119948505 missense probably damaging 0.98
R1188:Wnk1 UTSW 6 119948709 nonsense probably null
R1245:Wnk1 UTSW 6 119948457 missense probably benign 0.26
R1449:Wnk1 UTSW 6 119952818 missense probably damaging 1.00
R1469:Wnk1 UTSW 6 119950684 splice site probably benign
R1869:Wnk1 UTSW 6 119951089 missense probably damaging 1.00
R1871:Wnk1 UTSW 6 119951089 missense probably damaging 1.00
R1928:Wnk1 UTSW 6 119952923 missense probably damaging 1.00
R1959:Wnk1 UTSW 6 119969247 missense probably damaging 0.98
R1961:Wnk1 UTSW 6 119969247 missense probably damaging 0.98
R1964:Wnk1 UTSW 6 119934382 missense possibly damaging 0.86
R1983:Wnk1 UTSW 6 119937578 missense probably damaging 1.00
R2062:Wnk1 UTSW 6 119928157 splice site probably null
R2144:Wnk1 UTSW 6 119948988 unclassified probably benign
R2186:Wnk1 UTSW 6 119948567 missense probably benign 0.26
R2281:Wnk1 UTSW 6 119963640 splice site probably null
R2338:Wnk1 UTSW 6 119969534 missense probably benign 0.42
R2420:Wnk1 UTSW 6 119936367 critical splice donor site probably null
R3727:Wnk1 UTSW 6 119992453 missense probably damaging 1.00
R3773:Wnk1 UTSW 6 120002280 missense possibly damaging 0.88
R3836:Wnk1 UTSW 6 119950043 missense probably damaging 1.00
R3837:Wnk1 UTSW 6 119950043 missense probably damaging 1.00
R3847:Wnk1 UTSW 6 119969354 missense possibly damaging 0.70
R3903:Wnk1 UTSW 6 119949051 missense probably damaging 1.00
R4031:Wnk1 UTSW 6 119951068 missense probably damaging 1.00
R4095:Wnk1 UTSW 6 119948126 missense probably damaging 1.00
R4232:Wnk1 UTSW 6 119949261 missense possibly damaging 0.90
R4422:Wnk1 UTSW 6 119953895 missense probably benign 0.41
R4423:Wnk1 UTSW 6 119926426 missense probably damaging 1.00
R4572:Wnk1 UTSW 6 119951911 missense possibly damaging 0.49
R4704:Wnk1 UTSW 6 119965744 missense possibly damaging 0.83
R4755:Wnk1 UTSW 6 119963470 missense probably damaging 0.98
R4812:Wnk1 UTSW 6 119952771 missense probably benign 0.16
R4822:Wnk1 UTSW 6 119962438 missense probably benign 0.02
R4879:Wnk1 UTSW 6 119949377 missense probably damaging 1.00
R4970:Wnk1 UTSW 6 119965735 intron probably benign
R5002:Wnk1 UTSW 6 119937963 missense probably benign 0.13
R5037:Wnk1 UTSW 6 119965735 intron probably benign
R5152:Wnk1 UTSW 6 120002280 missense possibly damaging 0.88
R5257:Wnk1 UTSW 6 120037188 missense probably benign 0.00
R5354:Wnk1 UTSW 6 119968523 missense probably benign 0.01
R5421:Wnk1 UTSW 6 119952818 missense probably damaging 1.00
R5564:Wnk1 UTSW 6 119948891 unclassified probably benign
R5600:Wnk1 UTSW 6 119949358 missense probably damaging 1.00
R5847:Wnk1 UTSW 6 119992408 missense probably damaging 1.00
R6083:Wnk1 UTSW 6 120037601 missense probably damaging 0.99
R6110:Wnk1 UTSW 6 119972997 intron probably benign
R6128:Wnk1 UTSW 6 119963786 unclassified probably null
R6237:Wnk1 UTSW 6 119952767 missense probably damaging 1.00
R6341:Wnk1 UTSW 6 119948585 missense probably damaging 1.00
R6467:Wnk1 UTSW 6 119962955 missense probably benign 0.12
R6696:Wnk1 UTSW 6 119948282 missense probably damaging 1.00
R6888:Wnk1 UTSW 6 119948781 missense probably benign 0.26
R6923:Wnk1 UTSW 6 119965678 intron probably benign
R7024:Wnk1 UTSW 6 119965726 intron probably benign
R7072:Wnk1 UTSW 6 119937861 missense unknown
R7087:Wnk1 UTSW 6 120037530 missense possibly damaging 0.94
R7102:Wnk1 UTSW 6 119948307 missense unknown
R7134:Wnk1 UTSW 6 119926428 missense unknown
R7137:Wnk1 UTSW 6 120038212 unclassified probably benign
R7142:Wnk1 UTSW 6 119949279 missense probably benign 0.09
R7174:Wnk1 UTSW 6 119970978 missense probably damaging 1.00
R7218:Wnk1 UTSW 6 120002273 nonsense probably null
X0064:Wnk1 UTSW 6 120037032 missense possibly damaging 0.93
Predicted Primers
Posted On2014-03-28