Incidental Mutation 'R1185:Pgap3'
ID165263
Institutional Source Beutler Lab
Gene Symbol Pgap3
Ensembl Gene ENSMUSG00000038208
Gene Namepost-GPI attachment to proteins 3
SynonymsD430035D22Rik, Perld1, CAB2
MMRRC Submission 039257-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R1185 (G1)
Quality Score112
Status Not validated
Chromosome11
Chromosomal Location98388677-98400490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98391134 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 117 (D117G)
Ref Sequence ENSEMBL: ENSMUSP00000119668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041301] [ENSMUST00000090827] [ENSMUST00000128897]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000041218
Predicted Effect probably benign
Transcript: ENSMUST00000041301
SMART Domains Protein: ENSMUSP00000035549
Gene: ENSMUSG00000038216

DomainStartEndE-ValueType
Pfam:NNMT_PNMT_TEMT 25 290 1.2e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000090827
AA Change: D168G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088337
Gene: ENSMUSG00000038208
AA Change: D168G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Per1 54 306 6.3e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128058
Predicted Effect probably damaging
Transcript: ENSMUST00000128897
AA Change: D117G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119668
Gene: ENSMUSG00000038208
AA Change: D117G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Per1 51 96 6.2e-14 PFAM
Pfam:Per1 93 256 7.3e-59 PFAM
Meta Mutation Damage Score 0.48 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.3%
  • 10x: 93.0%
  • 20x: 79.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylphosphatidylinositol (GPI)-specific phospholipase that primarily localizes to the Golgi apparatus. This ubiquitously expressed gene is predicted to encode a seven-transmembrane protein that removes unsaturated fatty acids from the sn-2 position of GPI. The remodeling of the constituent fatty acids on GPI is thought to be important for the proper association between GPI-anchored proteins and lipid rafts. The tethering of proteins to plasma membranes via posttranslational GPI-anchoring is thought to play a role in protein sorting and trafficking. Mutations in this gene cause the autosomal recessive neurologic disorder hyperphosphatasia with mental retardation syndrome 4 (HPMRS4). Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal head and tail morphology, growth retardation, limb glasping, altered T cell proliferation response and increased susceptibility to EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ac165356.1 C T 7: 106,083,479 A190T probably benign Het
AC211878.1 A G 12: 87,773,708 V27A probably benign Het
Aimp2 A G 5: 143,904,691 S110P possibly damaging Het
Akap9 A G 5: 3,948,783 T51A probably benign Het
Arhgef25 A G 10: 127,183,781 F430L possibly damaging Het
Brap T C 5: 121,675,279 V235A probably damaging Het
CAAA01123846.1 C A 4: 156,351,101 A258D probably benign Het
Cd69 C T 6: 129,270,185 G23D probably damaging Het
Cecr2 C T 6: 120,758,205 R24* probably null Het
Celsr2 T C 3: 108,399,709 D1974G possibly damaging Het
Cps1 A G 1: 67,195,199 K915R probably benign Het
Csmd1 T C 8: 16,358,348 D401G probably damaging Het
Dusp13 A G 14: 21,735,018 F141S probably damaging Het
Fam162b A G 10: 51,590,343 W27R probably benign Het
Focad A G 4: 88,178,187 T269A probably benign Het
Ghr T A 15: 3,328,062 R241S possibly damaging Het
Hirip3 AAGAG AAG 7: 126,863,660 probably null Het
Itgb2l A G 16: 96,429,040 Y357H possibly damaging Het
Jrkl T C 9: 13,244,933 D241G possibly damaging Het
Lmod1 A G 1: 135,364,229 D274G probably benign Het
Lrrn2 A G 1: 132,939,221 S675G probably benign Het
Ltbp4 G C 7: 27,310,535 P1200R probably damaging Het
Mdn1 T C 4: 32,735,576 L3414P possibly damaging Het
Muc19 A G 15: 91,878,549 noncoding transcript Het
Neb A G 2: 52,296,298 Y921H probably damaging Het
Olfr135 T A 17: 38,209,183 *313R probably null Het
Ppp1r9b T C 11: 95,001,986 F671L possibly damaging Het
Purg T G 8: 33,386,869 Y178* probably null Het
Rsph10b G A 5: 143,966,462 probably benign Het
Sorbs1 T A 19: 40,382,606 D79V probably damaging Het
Tcaf3 T C 6: 42,591,434 T663A probably damaging Het
Timd4 C A 11: 46,817,648 T167K probably damaging Het
Tjp2 A G 19: 24,131,163 L195P possibly damaging Het
Tnr G A 1: 159,852,286 A277T probably benign Het
Trpm3 G A 19: 22,914,417 probably benign Het
Unc13a C T 8: 71,661,833 G181D probably benign Het
Vmn1r11 T A 6: 57,137,507 L52Q possibly damaging Het
Zfp27 T C 7: 29,895,829 D237G possibly damaging Het
Zfp39 T C 11: 58,902,844 T23A possibly damaging Het
Zfp459 T G 13: 67,408,481 N161T probably benign Het
Other mutations in Pgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01942:Pgap3 APN 11 98397954 missense probably damaging 1.00
IGL03409:Pgap3 APN 11 98398938 missense possibly damaging 0.95
R0053:Pgap3 UTSW 11 98391098 missense probably damaging 1.00
R0053:Pgap3 UTSW 11 98391098 missense probably damaging 1.00
R1185:Pgap3 UTSW 11 98391134 missense probably damaging 1.00
R1185:Pgap3 UTSW 11 98391134 missense probably damaging 1.00
R1579:Pgap3 UTSW 11 98390053 missense probably benign
R1938:Pgap3 UTSW 11 98400214 critical splice donor site probably null
R2117:Pgap3 UTSW 11 98391107 missense probably damaging 0.99
R2367:Pgap3 UTSW 11 98391159 intron probably null
R3854:Pgap3 UTSW 11 98390812 missense possibly damaging 0.49
R4820:Pgap3 UTSW 11 98390474 missense probably damaging 1.00
R5208:Pgap3 UTSW 11 98398048 missense probably damaging 1.00
R5493:Pgap3 UTSW 11 98390714 missense possibly damaging 0.87
R5783:Pgap3 UTSW 11 98390464 missense probably benign
X0026:Pgap3 UTSW 11 98390479 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CAAAGGGTTGAAGGCTCCCTGAAG -3'
(R):5'- TGCCCTCTCAATGCCATGAACG -3'

Sequencing Primer
(F):5'- TGGTTCAGAGAAACCAAGGCTC -3'
(R):5'- CCAGTCCTGTGCCATACTC -3'
Posted On2014-03-28