Incidental Mutation 'R1465:Setx'
ID165391
Institutional Source Beutler Lab
Gene Symbol Setx
Ensembl Gene ENSMUSG00000043535
Gene Namesenataxin
SynonymsA930037J23Rik, Als4
MMRRC Submission 039519-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1465 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location29124181-29182471 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 29140389 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000051492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061578]
Predicted Effect probably null
Transcript: ENSMUST00000061578
SMART Domains Protein: ENSMUSP00000051492
Gene: ENSMUSG00000043535

DomainStartEndE-ValueType
low complexity region 864 876 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
low complexity region 1058 1079 N/A INTRINSIC
low complexity region 1575 1594 N/A INTRINSIC
Pfam:AAA_11 1909 2194 1.9e-68 PFAM
Pfam:AAA_19 1924 2015 2.9e-11 PFAM
Pfam:AAA_12 2201 2402 1.1e-54 PFAM
low complexity region 2499 2516 N/A INTRINSIC
low complexity region 2576 2587 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 97.3%
  • 10x: 87.6%
  • 20x: 63.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein named for its homology to the Sen1p protein of fungi which has RNA helicase activity encoded by a domain at the C-terminal end of the protein. The protein encoded by this gene contains a DNA/RNA helicase domain at its C-terminal end which suggests that it may be involved in both DNA and RNA processing. Mutations in this gene have been associated with ataxia-ocular apraxia-2 (AOA2) and an autosomal dominant form of juvenile amyotrophic lateral sclerosis (ALS4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to arrested male meiosis and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,740,566 Y121H probably damaging Het
Abca13 G T 11: 9,399,303 G3626W probably damaging Het
Acvr1c A G 2: 58,284,961 Y192H probably damaging Het
Afm A T 5: 90,550,341 D534V probably damaging Het
Agl T C 3: 116,771,372 E1076G probably benign Het
Angptl3 A T 4: 99,037,520 H361L probably benign Het
Apob T C 12: 8,011,421 F3301S possibly damaging Het
Arhgef33 T A 17: 80,367,301 C376S possibly damaging Het
Ass1 A G 2: 31,520,416 *413W probably null Het
Atp6v1h T A 1: 5,095,688 L127Q probably damaging Het
Bcl2l1 G A 2: 152,829,950 S14F probably damaging Het
Birc6 G A 17: 74,623,858 A2477T probably benign Het
Bpifb9a G A 2: 154,271,021 A589T possibly damaging Het
Casp9 C A 4: 141,805,840 T252K probably benign Het
Cct4 G A 11: 23,002,922 D533N probably damaging Het
Clcn6 A C 4: 148,013,901 I555S probably damaging Het
Col4a4 A T 1: 82,497,822 probably null Het
Cyp2d10 A T 15: 82,403,928 probably null Het
D930048N14Rik A G 11: 51,654,913 probably benign Het
Dlg5 T C 14: 24,154,696 probably null Het
Dnah11 T C 12: 118,038,695 E2240G probably damaging Het
Dnmt3a A G 12: 3,866,088 E17G probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Dpy19l2 A G 9: 24,669,322 M241T probably benign Het
Dpy19l4 A G 4: 11,296,034 S212P probably damaging Het
Ephb6 T C 6: 41,616,106 F426S probably damaging Het
F5 A T 1: 164,198,833 D1658V probably benign Het
Faah A T 4: 115,999,558 V469E probably damaging Het
Fas T C 19: 34,316,613 C123R probably damaging Het
Fhod1 T C 8: 105,338,914 probably benign Het
Filip1 A G 9: 79,898,307 V55A probably benign Het
Frmpd1 G A 4: 45,273,197 R372Q probably damaging Het
Glyctk C T 9: 106,157,607 G87S probably damaging Het
Gm4737 T C 16: 46,153,848 K389E probably benign Het
Gm5096 T G 18: 87,757,258 F302V probably damaging Het
Golga3 T C 5: 110,209,878 L1080P probably damaging Het
Gpr137 T C 19: 6,938,444 T281A probably benign Het
Grap2 T A 15: 80,648,411 probably null Het
Hlcs T C 16: 94,268,292 D170G probably damaging Het
Hook1 A G 4: 96,013,256 T484A probably benign Het
Hoxa5 T A 6: 52,203,791 H187L probably benign Het
Inpp1 G T 1: 52,790,094 S255R probably benign Het
Inpp4b T A 8: 81,768,157 V67E probably damaging Het
Iqgap3 A G 3: 88,087,309 N105S probably damaging Het
Kcnq5 A G 1: 21,469,468 probably null Het
Klhl1 T C 14: 96,240,213 N473S probably benign Het
Klk1b24 C A 7: 44,191,361 T71N probably benign Het
Loxhd1 A G 18: 77,380,573 probably null Het
Lrp1b C T 2: 41,111,059 R2165Q probably benign Het
Lrp2bp A T 8: 46,025,235 Q328L possibly damaging Het
Lrrc63 T A 14: 75,107,389 K419N possibly damaging Het
Lrrc9 A G 12: 72,500,759 N150S probably benign Het
Lrrn4 C A 2: 132,872,075 C317F probably damaging Het
Ltbp2 T C 12: 84,813,300 S627G probably damaging Het
Macf1 A T 4: 123,493,154 S1224T probably damaging Het
Meis2 A C 2: 116,058,670 H200Q probably benign Het
Mesd C A 7: 83,895,582 A80E probably benign Het
Mroh2a G C 1: 88,257,802 E1510D probably damaging Het
Myo3a T C 2: 22,577,927 F398L probably benign Het
Nanp A G 2: 151,030,829 C60R probably benign Het
Nectin2 T G 7: 19,730,116 M313L probably benign Het
Nek4 C T 14: 30,956,887 H123Y probably damaging Het
Nploc4 A G 11: 120,408,781 V371A probably damaging Het
Olfr1463 T A 19: 13,234,901 V217E possibly damaging Het
Olfr156 A G 4: 43,820,723 F213L probably benign Het
Olfr658 T C 7: 104,644,946 N140S probably benign Het
Olfr740 A G 14: 50,453,177 T42A possibly damaging Het
Pcdh20 T A 14: 88,469,237 Q209L probably benign Het
Pcdhb20 G A 18: 37,504,697 R92H probably damaging Het
Pgap1 T C 1: 54,528,555 H377R probably benign Het
Phyhipl G T 10: 70,570,968 P52Q probably damaging Het
Pwwp2a T A 11: 43,705,556 V516E possibly damaging Het
Rack1 T C 11: 48,801,759 V69A probably damaging Het
Rexo5 T A 7: 119,801,358 probably null Het
Rock1 G T 18: 10,072,863 Q1161K possibly damaging Het
Rps6ka2 T C 17: 7,292,867 L568P probably damaging Het
Seh1l T C 18: 67,783,984 S78P probably damaging Het
Serpinb3b A T 1: 107,155,843 probably null Het
Setd1a T C 7: 127,788,340 probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Shc2 G T 10: 79,631,302 R146S probably damaging Het
Skap2 T C 6: 51,909,368 T5A probably benign Het
Slc35a3 T C 3: 116,687,334 I93M probably benign Het
Sohlh1 C T 2: 25,843,347 G295D probably damaging Het
Sult2a8 A C 7: 14,416,283 C168G probably benign Het
Tbc1d4 T C 14: 101,447,688 I1176V possibly damaging Het
Thada A T 17: 84,436,676 F735I possibly damaging Het
Tle1 A C 4: 72,139,831 H52Q probably damaging Het
Tmem101 A T 11: 102,153,329 V244E probably damaging Het
Tnfrsf26 C A 7: 143,617,931 C95F probably damaging Het
Uspl1 T C 5: 149,214,032 S482P probably benign Het
Vmn2r118 G T 17: 55,610,935 N192K probably benign Het
Vmn2r14 C T 5: 109,220,329 V266I possibly damaging Het
Vmn2r51 A G 7: 10,100,322 I263T probably damaging Het
Zfp937 T A 2: 150,239,047 C332* probably null Het
Zscan21 T A 5: 138,125,208 S50T probably benign Het
Other mutations in Setx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Setx APN 2 29148445 missense possibly damaging 0.50
IGL00806:Setx APN 2 29127026 missense probably damaging 1.00
IGL01346:Setx APN 2 29144809 missense probably damaging 1.00
IGL01623:Setx APN 2 29163009 missense possibly damaging 0.70
IGL02351:Setx APN 2 29146964 missense probably benign 0.45
IGL02358:Setx APN 2 29146964 missense probably benign 0.45
IGL02378:Setx APN 2 29173726 splice site probably benign
IGL02388:Setx APN 2 29173653 missense probably damaging 1.00
IGL02408:Setx APN 2 29133930 missense probably damaging 1.00
IGL02425:Setx APN 2 29148408 missense probably benign 0.00
IGL03023:Setx APN 2 29145902 missense probably benign 0.02
IGL03351:Setx APN 2 29161799 missense probably benign 0.25
addison UTSW 2 29158905 missense probably damaging 1.00
dallas UTSW 2 29154061 frame shift probably null
denton UTSW 2 29145060 missense possibly damaging 0.81
doggie UTSW 2 29164550 missense probably damaging 1.00
Irving UTSW 2 29139221 missense probably damaging 0.99
IGL03014:Setx UTSW 2 29139411 missense probably damaging 1.00
PIT4403001:Setx UTSW 2 29133955 missense probably damaging 1.00
R0027:Setx UTSW 2 29139221 missense probably damaging 0.99
R0031:Setx UTSW 2 29176929 missense probably benign 0.02
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0092:Setx UTSW 2 29146293 missense probably benign 0.00
R0193:Setx UTSW 2 29179673 missense probably benign 0.21
R0281:Setx UTSW 2 29179643 missense probably benign 0.00
R0401:Setx UTSW 2 29166289 nonsense probably null
R0413:Setx UTSW 2 29139278 missense probably damaging 1.00
R0517:Setx UTSW 2 29157133 missense probably benign 0.00
R0536:Setx UTSW 2 29158248 missense possibly damaging 0.46
R0617:Setx UTSW 2 29146807 missense possibly damaging 0.86
R1183:Setx UTSW 2 29180092 missense probably benign
R1331:Setx UTSW 2 29179686 missense probably benign
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1482:Setx UTSW 2 29162992 missense probably damaging 0.99
R1599:Setx UTSW 2 29140373 missense probably benign 0.04
R1663:Setx UTSW 2 29126905 missense probably damaging 1.00
R1909:Setx UTSW 2 29163009 missense possibly damaging 0.70
R2117:Setx UTSW 2 29130301 missense probably benign 0.01
R2207:Setx UTSW 2 29154061 frame shift probably null
R2221:Setx UTSW 2 29154061 frame shift probably null
R2223:Setx UTSW 2 29148537 missense possibly damaging 0.89
R2223:Setx UTSW 2 29154061 frame shift probably null
R2273:Setx UTSW 2 29154061 frame shift probably null
R2274:Setx UTSW 2 29154061 frame shift probably null
R2275:Setx UTSW 2 29154061 frame shift probably null
R2309:Setx UTSW 2 29158904 missense probably damaging 1.00
R2328:Setx UTSW 2 29154060 frame shift probably null
R2328:Setx UTSW 2 29154061 frame shift probably null
R2329:Setx UTSW 2 29154061 frame shift probably null
R2331:Setx UTSW 2 29154061 frame shift probably null
R2332:Setx UTSW 2 29154061 frame shift probably null
R2429:Setx UTSW 2 29179898 missense probably benign 0.00
R2438:Setx UTSW 2 29154061 frame shift probably null
R2439:Setx UTSW 2 29154061 frame shift probably null
R2496:Setx UTSW 2 29144801 missense probably benign 0.11
R2858:Setx UTSW 2 29154061 frame shift probably null
R2859:Setx UTSW 2 29154061 frame shift probably null
R2884:Setx UTSW 2 29148625 missense probably damaging 0.98
R2885:Setx UTSW 2 29148625 missense probably damaging 0.98
R2886:Setx UTSW 2 29148625 missense probably damaging 0.98
R2915:Setx UTSW 2 29172324 missense probably damaging 0.99
R2921:Setx UTSW 2 29154060 small deletion probably benign
R2921:Setx UTSW 2 29154061 frame shift probably null
R2923:Setx UTSW 2 29154061 frame shift probably null
R3426:Setx UTSW 2 29154061 frame shift probably null
R3609:Setx UTSW 2 29154061 frame shift probably null
R3610:Setx UTSW 2 29154061 frame shift probably null
R3731:Setx UTSW 2 29154061 frame shift probably null
R3813:Setx UTSW 2 29154061 frame shift probably null
R3835:Setx UTSW 2 29145060 missense possibly damaging 0.81
R3871:Setx UTSW 2 29145741 missense probably damaging 0.98
R4013:Setx UTSW 2 29154061 frame shift probably null
R4014:Setx UTSW 2 29154061 frame shift probably null
R4015:Setx UTSW 2 29154061 frame shift probably null
R4017:Setx UTSW 2 29154061 frame shift probably null
R4246:Setx UTSW 2 29154061 frame shift probably null
R4248:Setx UTSW 2 29154061 frame shift probably null
R4297:Setx UTSW 2 29154061 frame shift probably null
R4298:Setx UTSW 2 29154061 frame shift probably null
R4539:Setx UTSW 2 29179748 missense probably benign 0.14
R4590:Setx UTSW 2 29144809 missense probably damaging 1.00
R4632:Setx UTSW 2 29148615 missense probably benign 0.23
R4782:Setx UTSW 2 29144046 missense probably damaging 0.99
R4801:Setx UTSW 2 29146373 missense probably benign 0.14
R4802:Setx UTSW 2 29146373 missense probably benign 0.14
R4975:Setx UTSW 2 29164550 missense probably damaging 1.00
R5040:Setx UTSW 2 29139338 missense probably damaging 1.00
R5133:Setx UTSW 2 29180081 missense probably benign 0.02
R5208:Setx UTSW 2 29166367 missense possibly damaging 0.63
R5237:Setx UTSW 2 29146983 missense probably benign 0.00
R5248:Setx UTSW 2 29148418 missense probably benign 0.26
R5288:Setx UTSW 2 29134033 critical splice donor site probably null
R5385:Setx UTSW 2 29134033 critical splice donor site probably null
R5387:Setx UTSW 2 29147594 missense probably benign 0.00
R5407:Setx UTSW 2 29145474 missense probably benign 0.00
R5685:Setx UTSW 2 29171280 missense probably damaging 1.00
R6110:Setx UTSW 2 29140290 missense probably damaging 1.00
R6136:Setx UTSW 2 29148027 missense probably benign 0.01
R6310:Setx UTSW 2 29176935 missense possibly damaging 0.57
R6328:Setx UTSW 2 29174462 intron probably benign
R6358:Setx UTSW 2 29171348 missense possibly damaging 0.79
R6384:Setx UTSW 2 29173558 missense probably damaging 1.00
R6400:Setx UTSW 2 29130274 missense probably damaging 0.97
R6572:Setx UTSW 2 29173694 missense possibly damaging 0.63
R6662:Setx UTSW 2 29158114 missense probably damaging 0.97
R6898:Setx UTSW 2 29148108 missense probably benign 0.00
R7188:Setx UTSW 2 29148172 missense probably benign 0.02
R7332:Setx UTSW 2 29146626 missense probably benign 0.00
R7357:Setx UTSW 2 29130301 missense probably benign 0.01
R7556:Setx UTSW 2 29146493 missense possibly damaging 0.88
X0066:Setx UTSW 2 29147879 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTCTGCTGCTTGACTTGCTGC -3'
(R):5'- AGGCTGTGCTAAAGCACTTCCTC -3'

Sequencing Primer
(F):5'- TTGACTTGCTGCCCTGC -3'
(R):5'- ggttttgcttttgttttttggttttg -3'
Posted On2014-03-28