Incidental Mutation 'R1488:Tubgcp4'
ID165482
Institutional Source Beutler Lab
Gene Symbol Tubgcp4
Ensembl Gene ENSMUSG00000027263
Gene Nametubulin, gamma complex associated protein 4
SynonymsD2Ertd435e, 4932441P04Rik
MMRRC Submission 039540-MU
Accession Numbers

Genbank: NM_153387

Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R1488 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location121170654-121198770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 121176550 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 136 (V136G)
Ref Sequence ENSEMBL: ENSMUSP00000106285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039541] [ENSMUST00000110657] [ENSMUST00000110658] [ENSMUST00000186659]
Predicted Effect probably benign
Transcript: ENSMUST00000039541
AA Change: V136G

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000044049
Gene: ENSMUSG00000027263
AA Change: V136G

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 573 2.8e-111 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110657
AA Change: V136G

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106285
Gene: ENSMUSG00000027263
AA Change: V136G

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 3.1e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110658
AA Change: V136G

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106286
Gene: ENSMUSG00000027263
AA Change: V136G

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 4.1e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154633
Predicted Effect probably benign
Transcript: ENSMUST00000186659
AA Change: V136G

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000140417
Gene: ENSMUSG00000027263
AA Change: V136G

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 4.1e-115 PFAM
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the gamma-tubulin ring complex, which is required for microtubule nucleation. In mammalian cells, the protein localizes to centrosomes in association with gamma-tubulin. Crystal structure analysis revealed a structure composed of five helical bundles arranged around conserved hydrophobic cores. An exposed surface area located in the C-terminal domain is essential and sufficient for direct binding to gamma-tubulin. Mutations in this gene that alter microtubule organization are associated with microcephaly and chorioretinopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,933,447 N691S possibly damaging Het
Arhgap23 A G 11: 97,500,859 S1401G possibly damaging Het
Art2b A C 7: 101,580,207 F162V probably damaging Het
Atg4c T A 4: 99,221,242 W149R probably damaging Het
Atxn1l A G 8: 109,733,417 I71T probably benign Het
Axdnd1 T A 1: 156,348,960 L748F probably damaging Het
Bdh2 A G 3: 135,296,841 Y157C probably damaging Het
C2cd4a G T 9: 67,831,708 R18S probably benign Het
Catsperb A G 12: 101,594,267 H839R probably damaging Het
Ccdc24 C A 4: 117,870,568 S134I possibly damaging Het
Cd55 G T 1: 130,448,378 T70K probably damaging Het
Cdh10 A T 15: 19,013,263 I650F probably damaging Het
Clca2 T A 3: 145,084,164 K470N possibly damaging Het
Csn2 G A 5: 87,694,896 Q91* probably null Het
Ctsh G A 9: 90,071,891 D218N possibly damaging Het
Cyb5r4 C G 9: 87,029,538 Y88* probably null Het
Dgkq A G 5: 108,650,877 F601S probably damaging Het
Eci2 A G 13: 34,977,933 V352A probably benign Het
Krt28 T C 11: 99,365,171 T421A probably benign Het
Lamp5 T C 2: 136,069,091 V248A probably benign Het
Lin9 T A 1: 180,688,285 L483Q possibly damaging Het
Lrp1b C A 2: 41,502,024 M509I probably benign Het
Lrrfip1 T C 1: 91,114,632 V253A probably damaging Het
Mpdz C A 4: 81,348,708 E981* probably null Het
Mpo A C 11: 87,797,430 N305T probably damaging Het
Olfr1385 A G 11: 49,495,118 E195G probably benign Het
Olfr507 A T 7: 108,622,489 I226F probably damaging Het
Olfr645 T C 7: 104,084,652 I143V probably benign Het
Papss2 T C 19: 32,637,090 S69P probably benign Het
Pcdhb22 A G 18: 37,519,888 T470A possibly damaging Het
Plce1 A G 19: 38,716,803 D884G possibly damaging Het
Prex2 T A 1: 11,193,528 I1239K probably benign Het
Prkd2 T A 7: 16,858,439 F625I probably damaging Het
Rab20 A T 8: 11,454,268 V144E probably benign Het
Rnf213 A G 11: 119,480,889 N4840S probably benign Het
Scaf8 T G 17: 3,197,597 M1065R probably damaging Het
Slco3a1 A G 7: 74,346,701 L319P possibly damaging Het
Slit1 A G 19: 41,608,385 C1092R probably damaging Het
Tlr4 A G 4: 66,839,549 D193G probably damaging Het
Tmem145 T A 7: 25,307,435 probably null Het
Tmem184a T A 5: 139,807,640 K235N probably benign Het
Tnpo1 A T 13: 98,856,907 D590E probably damaging Het
Trio C A 15: 27,740,967 G2724V probably damaging Het
Ttc6 A T 12: 57,649,515 Y34F possibly damaging Het
Tuba4a T C 1: 75,216,401 T190A probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r74 T C 7: 11,847,583 I270T probably benign Het
Vmn2r103 A T 17: 19,793,660 E238V probably damaging Het
Vmn2r60 T A 7: 42,136,713 F313L probably benign Het
Zfp710 T C 7: 80,082,004 Y310H probably damaging Het
Other mutations in Tubgcp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Tubgcp4 APN 2 121178701 missense probably damaging 0.99
IGL01112:Tubgcp4 APN 2 121173601 missense probably benign 0.10
IGL01149:Tubgcp4 APN 2 121184783 missense probably null 0.00
IGL01869:Tubgcp4 APN 2 121175788 missense possibly damaging 0.95
IGL01873:Tubgcp4 APN 2 121188184 critical splice donor site probably null
IGL01888:Tubgcp4 APN 2 121184747 missense probably benign 0.15
IGL03060:Tubgcp4 APN 2 121176590
IGL03333:Tubgcp4 APN 2 121196173 unclassified probably null
FR4589:Tubgcp4 UTSW 2 121175463 critical splice donor site probably benign
G5030:Tubgcp4 UTSW 2 121184334 missense probably damaging 1.00
R0482:Tubgcp4 UTSW 2 121175374 missense probably benign 0.02
R0512:Tubgcp4 UTSW 2 121175419 missense probably benign 0.06
R1433:Tubgcp4 UTSW 2 121175424 nonsense probably null
R1699:Tubgcp4 UTSW 2 121189893 nonsense probably null
R1760:Tubgcp4 UTSW 2 121189471 critical splice donor site probably null
R1935:Tubgcp4 UTSW 2 121178666 splice site probably benign
R2249:Tubgcp4 UTSW 2 121183629 missense possibly damaging 0.86
R4093:Tubgcp4 UTSW 2 121195477 missense probably benign 0.01
R4422:Tubgcp4 UTSW 2 121189401 nonsense probably null
R4433:Tubgcp4 UTSW 2 121184473 missense probably benign 0.01
R4541:Tubgcp4 UTSW 2 121195426 missense probably benign 0.01
R4670:Tubgcp4 UTSW 2 121173665 nonsense probably null
R4873:Tubgcp4 UTSW 2 121184849 intron probably benign
R4877:Tubgcp4 UTSW 2 121189862 missense probably benign
R5044:Tubgcp4 UTSW 2 121173580 missense probably damaging 1.00
R5436:Tubgcp4 UTSW 2 121188136 missense probably damaging 1.00
R5436:Tubgcp4 UTSW 2 121194182 missense probably benign 0.01
R5566:Tubgcp4 UTSW 2 121184770 missense possibly damaging 0.61
R6110:Tubgcp4 UTSW 2 121194108 missense probably benign 0.02
R6700:Tubgcp4 UTSW 2 121189848 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGATTGACTTAGGATGCCCAACTTGAC -3'
(R):5'- CTTGTCCCTATTCAAAGCCAGAGGTTC -3'

Sequencing Primer
(F):5'- cgtcctgaaacactgtaaacc -3'
(R):5'- CTCAGCAACATTCTTAGGTAGAGC -3'
Posted On2014-03-28