Incidental Mutation 'R1488:Csn2'
ID165491
Institutional Source Beutler Lab
Gene Symbol Csn2
Ensembl Gene ENSMUSG00000063157
Gene Namecasein beta
SynonymsCsnb, CSN2
MMRRC Submission 039540-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.012) question?
Stock #R1488 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location87692624-87699630 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 87694896 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 91 (Q91*)
Ref Sequence ENSEMBL: ENSMUSP00000143409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082370] [ENSMUST00000196163] [ENSMUST00000196869] [ENSMUST00000197422] [ENSMUST00000198057] [ENSMUST00000199624]
Predicted Effect probably null
Transcript: ENSMUST00000082370
AA Change: Q90*
SMART Domains Protein: ENSMUSP00000080976
Gene: ENSMUSG00000063157
AA Change: Q90*

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Casein 142 221 1.5e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000196163
AA Change: Q83*
SMART Domains Protein: ENSMUSP00000142673
Gene: ENSMUSG00000063157
AA Change: Q83*

DomainStartEndE-ValueType
Pfam:Casein 134 215 1.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196664
Predicted Effect probably null
Transcript: ENSMUST00000196869
AA Change: Q75*
SMART Domains Protein: ENSMUSP00000142971
Gene: ENSMUSG00000063157
AA Change: Q75*

DomainStartEndE-ValueType
Pfam:Casein 126 207 3.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197281
Predicted Effect probably null
Transcript: ENSMUST00000197422
AA Change: Q91*
SMART Domains Protein: ENSMUSP00000143341
Gene: ENSMUSG00000063157
AA Change: Q91*

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Casein 142 223 4.8e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197687
Predicted Effect probably null
Transcript: ENSMUST00000198057
AA Change: Q90*
SMART Domains Protein: ENSMUSP00000143709
Gene: ENSMUSG00000063157
AA Change: Q90*

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Casein 141 220 4.2e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000199624
AA Change: Q91*
SMART Domains Protein: ENSMUSP00000143409
Gene: ENSMUSG00000063157
AA Change: Q91*

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Casein 142 223 4.8e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200627
Meta Mutation Damage Score 0.6384 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta casein family. There are two types of casein protein, beta (encoded by this gene) and kappa, both of which are secreted in human milk. Beta casein is the principal protein in human milk and the primary source of essential amino acids for a suckling infant. Beta and kappa casein proteins acting together form spherical micelles which bind within them important dietary minerals, such as calcium and phosphorous. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Female mice homozygous for disruption of this gene produce mile with a low protein content and poor nutritional value. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,933,447 N691S possibly damaging Het
Arhgap23 A G 11: 97,500,859 S1401G possibly damaging Het
Art2b A C 7: 101,580,207 F162V probably damaging Het
Atg4c T A 4: 99,221,242 W149R probably damaging Het
Atxn1l A G 8: 109,733,417 I71T probably benign Het
Axdnd1 T A 1: 156,348,960 L748F probably damaging Het
Bdh2 A G 3: 135,296,841 Y157C probably damaging Het
C2cd4a G T 9: 67,831,708 R18S probably benign Het
Catsperb A G 12: 101,594,267 H839R probably damaging Het
Ccdc24 C A 4: 117,870,568 S134I possibly damaging Het
Cd55 G T 1: 130,448,378 T70K probably damaging Het
Cdh10 A T 15: 19,013,263 I650F probably damaging Het
Clca2 T A 3: 145,084,164 K470N possibly damaging Het
Ctsh G A 9: 90,071,891 D218N possibly damaging Het
Cyb5r4 C G 9: 87,029,538 Y88* probably null Het
Dgkq A G 5: 108,650,877 F601S probably damaging Het
Eci2 A G 13: 34,977,933 V352A probably benign Het
Krt28 T C 11: 99,365,171 T421A probably benign Het
Lamp5 T C 2: 136,069,091 V248A probably benign Het
Lin9 T A 1: 180,688,285 L483Q possibly damaging Het
Lrp1b C A 2: 41,502,024 M509I probably benign Het
Lrrfip1 T C 1: 91,114,632 V253A probably damaging Het
Mpdz C A 4: 81,348,708 E981* probably null Het
Mpo A C 11: 87,797,430 N305T probably damaging Het
Olfr1385 A G 11: 49,495,118 E195G probably benign Het
Olfr507 A T 7: 108,622,489 I226F probably damaging Het
Olfr645 T C 7: 104,084,652 I143V probably benign Het
Papss2 T C 19: 32,637,090 S69P probably benign Het
Pcdhb22 A G 18: 37,519,888 T470A possibly damaging Het
Plce1 A G 19: 38,716,803 D884G possibly damaging Het
Prex2 T A 1: 11,193,528 I1239K probably benign Het
Prkd2 T A 7: 16,858,439 F625I probably damaging Het
Rab20 A T 8: 11,454,268 V144E probably benign Het
Rnf213 A G 11: 119,480,889 N4840S probably benign Het
Scaf8 T G 17: 3,197,597 M1065R probably damaging Het
Slco3a1 A G 7: 74,346,701 L319P possibly damaging Het
Slit1 A G 19: 41,608,385 C1092R probably damaging Het
Tlr4 A G 4: 66,839,549 D193G probably damaging Het
Tmem145 T A 7: 25,307,435 probably null Het
Tmem184a T A 5: 139,807,640 K235N probably benign Het
Tnpo1 A T 13: 98,856,907 D590E probably damaging Het
Trio C A 15: 27,740,967 G2724V probably damaging Het
Ttc6 A T 12: 57,649,515 Y34F possibly damaging Het
Tuba4a T C 1: 75,216,401 T190A probably benign Het
Tubgcp4 T G 2: 121,176,550 V136G possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r74 T C 7: 11,847,583 I270T probably benign Het
Vmn2r103 A T 17: 19,793,660 E238V probably damaging Het
Vmn2r60 T A 7: 42,136,713 F313L probably benign Het
Zfp710 T C 7: 80,082,004 Y310H probably damaging Het
Other mutations in Csn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Csn2 APN 5 87694773 missense probably benign 0.01
IGL01458:Csn2 APN 5 87696020 splice site probably benign
IGL01526:Csn2 APN 5 87694979 missense possibly damaging 0.92
IGL01588:Csn2 APN 5 87694649 missense probably benign 0.08
IGL02034:Csn2 APN 5 87696082 splice site probably benign
IGL02277:Csn2 APN 5 87698022 splice site probably benign
IGL03267:Csn2 APN 5 87698071 missense possibly damaging 0.85
R0730:Csn2 UTSW 5 87694952 missense possibly damaging 0.85
R1055:Csn2 UTSW 5 87694737 missense possibly damaging 0.93
R2076:Csn2 UTSW 5 87696174 missense probably damaging 0.99
R4039:Csn2 UTSW 5 87698076 start codon destroyed probably null 0.33
R4322:Csn2 UTSW 5 87698027 critical splice donor site probably null
R5207:Csn2 UTSW 5 87694962 nonsense probably null
R5362:Csn2 UTSW 5 87694649 missense probably benign 0.01
R6191:Csn2 UTSW 5 87696026 critical splice donor site probably null
R6600:Csn2 UTSW 5 87694632 missense probably benign 0.25
Z1088:Csn2 UTSW 5 87696009 intron probably benign
Predicted Primers PCR Primer
(F):5'- TTATGAGGCGGAGCACAGTTTCAG -3'
(R):5'- GCCTTAATCTGTACCCCAGGATTGC -3'

Sequencing Primer
(F):5'- TTTCAGAGTTAAGGAGGGGCATC -3'
(R):5'- TACCCCAGGATTGCCTAGAATTTAC -3'
Posted On2014-03-28