Incidental Mutation 'R1493:Ankrd27'
ID165543
Institutional Source Beutler Lab
Gene Symbol Ankrd27
Ensembl Gene ENSMUSG00000034867
Gene Nameankyrin repeat domain 27 (VPS9 domain)
SynonymsD330003H11Rik, Varp
MMRRC Submission 039544-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.461) question?
Stock #R1493 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location35586244-35639226 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35608365 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 343 (S343L)
Ref Sequence ENSEMBL: ENSMUSP00000140259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040844] [ENSMUST00000186245] [ENSMUST00000190503] [ENSMUST00000206157] [ENSMUST00000206472]
Predicted Effect probably benign
Transcript: ENSMUST00000040844
AA Change: S343L

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000041751
Gene: ENSMUSG00000034867
AA Change: S343L

DomainStartEndE-ValueType
Blast:ANK 8 37 2e-8 BLAST
VPS9 264 380 1.92e-7 SMART
Blast:ANK 393 418 8e-9 BLAST
low complexity region 419 430 N/A INTRINSIC
ANK 462 491 8.65e-5 SMART
ANK 495 524 1.8e-2 SMART
ANK 528 558 2.45e-4 SMART
ANK 564 593 6.46e-4 SMART
low complexity region 638 658 N/A INTRINSIC
ANK 742 774 8.39e-3 SMART
ANK 775 804 5.93e-3 SMART
ANK 808 837 4.46e-7 SMART
ANK 841 870 2.81e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186245
AA Change: S343L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140554
Gene: ENSMUSG00000034867
AA Change: S343L

DomainStartEndE-ValueType
Blast:ANK 8 37 1e-8 BLAST
VPS9 264 377 2.19e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187567
Predicted Effect probably benign
Transcript: ENSMUST00000190503
AA Change: S343L

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000140259
Gene: ENSMUSG00000034867
AA Change: S343L

DomainStartEndE-ValueType
Blast:ANK 8 37 2e-8 BLAST
VPS9 264 380 1.92e-7 SMART
Blast:ANK 393 418 7e-9 BLAST
low complexity region 419 430 N/A INTRINSIC
ANK 462 491 8.65e-5 SMART
ANK 495 524 1.8e-2 SMART
ANK 528 558 2.45e-4 SMART
ANK 564 593 6.46e-4 SMART
low complexity region 638 658 N/A INTRINSIC
ANK 687 719 8.39e-3 SMART
ANK 720 749 5.93e-3 SMART
ANK 753 782 4.46e-7 SMART
ANK 786 815 2.81e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205801
Predicted Effect probably benign
Transcript: ENSMUST00000206157
Predicted Effect probably benign
Transcript: ENSMUST00000206472
AA Change: S343L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Abca15 A T 7: 120,382,290 D989V probably benign Het
Abcg8 T C 17: 84,696,679 S472P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Adprm A G 11: 67,041,876 V69A possibly damaging Het
Arfgef3 A G 10: 18,630,879 S833P probably damaging Het
Arhgap42 T G 9: 9,030,797 E339D probably benign Het
Axdnd1 T A 1: 156,346,701 M799L probably benign Het
Cars2 A T 8: 11,517,817 probably null Het
Cd7 T C 11: 121,038,141 T95A probably damaging Het
Cep290 A T 10: 100,562,181 T2200S probably benign Het
Cep44 A G 8: 56,532,835 S299P probably damaging Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Ehbp1 T A 11: 22,006,866 E1204V probably damaging Het
Fam129a T A 1: 151,706,090 V479D probably damaging Het
Fam208a A G 14: 27,449,969 S425G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm4559 A T 7: 142,274,313 C17* probably null Het
Gm9833 A G 3: 10,088,884 K238E probably damaging Het
Helz A G 11: 107,613,925 I413V probably benign Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Hrh1 G A 6: 114,480,877 G373D probably damaging Het
Hs3st5 G A 10: 36,832,874 G135D probably damaging Het
Iqcf6 T C 9: 106,627,442 Y102H probably benign Het
Kmt2a A T 9: 44,846,905 S1124R probably damaging Het
Map3k5 A G 10: 20,029,113 D387G probably damaging Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Musk C T 4: 58,354,003 A352V probably benign Het
Nans G A 4: 46,500,761 E218K probably damaging Het
Ninl T G 2: 150,980,095 D29A probably damaging Het
Nod1 A G 6: 54,944,056 F426L probably damaging Het
Notch4 T A 17: 34,567,682 C265* probably null Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr555 T C 7: 102,659,013 L64P probably damaging Het
Olfr670 T A 7: 104,960,502 T77S probably damaging Het
Orai3 G A 7: 127,773,905 V193M possibly damaging Het
Prkag1 T C 15: 98,813,670 Y271C probably benign Het
Rfc4 T C 16: 23,118,008 I116V probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Rnmt G A 18: 68,313,707 D268N probably damaging Het
Rsph1 C T 17: 31,265,899 G139D probably damaging Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Shmt2 A G 10: 127,518,943 probably null Het
Sorbs3 T C 14: 70,192,627 T353A possibly damaging Het
Stk25 T C 1: 93,625,600 T260A probably benign Het
Thap12 A G 7: 98,715,438 H271R probably benign Het
Tmprss13 A G 9: 45,336,107 T256A probably benign Het
Tpo A T 12: 30,131,809 I29N possibly damaging Het
Trpc2 A T 7: 102,090,576 N569I probably damaging Het
Unc13c T C 9: 73,639,068 T1607A probably benign Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Vps18 A G 2: 119,297,132 Y812C probably damaging Het
Zfp692 A T 11: 58,314,040 I409F probably damaging Het
Zfp735 G A 11: 73,710,479 C83Y possibly damaging Het
Zic1 A G 9: 91,364,756 S88P probably damaging Het
Other mutations in Ankrd27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Ankrd27 APN 7 35614456 missense probably damaging 0.99
IGL02205:Ankrd27 APN 7 35616939 missense probably damaging 1.00
IGL02372:Ankrd27 APN 7 35633036 unclassified probably null
IGL02629:Ankrd27 APN 7 35625696 missense probably benign 0.00
IGL03394:Ankrd27 APN 7 35607098 splice site probably null
R0008:Ankrd27 UTSW 7 35603700 missense probably benign 0.11
R0008:Ankrd27 UTSW 7 35603700 missense probably benign 0.11
R0233:Ankrd27 UTSW 7 35601560 missense probably damaging 1.00
R0233:Ankrd27 UTSW 7 35601560 missense probably damaging 1.00
R0240:Ankrd27 UTSW 7 35619439 missense probably damaging 1.00
R0240:Ankrd27 UTSW 7 35619439 missense probably damaging 1.00
R0281:Ankrd27 UTSW 7 35619371 missense probably damaging 0.98
R0373:Ankrd27 UTSW 7 35638053 missense probably benign 0.00
R0833:Ankrd27 UTSW 7 35608347 missense probably damaging 1.00
R0836:Ankrd27 UTSW 7 35608347 missense probably damaging 1.00
R1191:Ankrd27 UTSW 7 35602487 missense probably damaging 0.96
R1394:Ankrd27 UTSW 7 35615869 missense possibly damaging 0.80
R1395:Ankrd27 UTSW 7 35615869 missense possibly damaging 0.80
R1648:Ankrd27 UTSW 7 35603853 missense probably benign 0.00
R1664:Ankrd27 UTSW 7 35607126 missense probably damaging 1.00
R1698:Ankrd27 UTSW 7 35614521 missense probably benign 0.01
R1717:Ankrd27 UTSW 7 35628446 missense probably damaging 0.98
R1919:Ankrd27 UTSW 7 35632985 missense probably benign
R1956:Ankrd27 UTSW 7 35603839 missense probably damaging 1.00
R2276:Ankrd27 UTSW 7 35615840 unclassified probably benign
R3000:Ankrd27 UTSW 7 35608330 missense probably damaging 1.00
R4604:Ankrd27 UTSW 7 35628490 missense probably damaging 1.00
R4647:Ankrd27 UTSW 7 35638234 missense probably benign
R4838:Ankrd27 UTSW 7 35591806 missense possibly damaging 0.87
R4896:Ankrd27 UTSW 7 35608375 missense probably damaging 1.00
R4973:Ankrd27 UTSW 7 35632992 missense probably benign
R5004:Ankrd27 UTSW 7 35608375 missense probably damaging 1.00
R5069:Ankrd27 UTSW 7 35628435 missense probably damaging 0.98
R5182:Ankrd27 UTSW 7 35628487 missense probably damaging 1.00
R5330:Ankrd27 UTSW 7 35615926 nonsense probably null
R5458:Ankrd27 UTSW 7 35591811 missense probably damaging 1.00
R6293:Ankrd27 UTSW 7 35608460 missense possibly damaging 0.65
R6341:Ankrd27 UTSW 7 35627403 critical splice acceptor site probably null
R6721:Ankrd27 UTSW 7 35612551 missense probably damaging 1.00
R6860:Ankrd27 UTSW 7 35628527 missense possibly damaging 0.62
R7027:Ankrd27 UTSW 7 35612526 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTGCAGGTCATCTCCAGCTTTC -3'
(R):5'- CCGGCTACTGACAGTGTAAATCCC -3'

Sequencing Primer
(F):5'- GCCTTTCCCAGGAAGTAACTCATAG -3'
(R):5'- TGACAGTGTAAATCCCACTGG -3'
Posted On2014-03-28